We narrowed to 12,644 results for: PAC;
-
Plasmid#99695PurposeExpresses dSa Cas9 fused to gold standard VP64 activator domain and Sa sgRNA for Neurog2 promoter, vector allows for activation of mouse Neurog2, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Neurog2 (gRNA: GGTATATAAGGGGTTTTAAG) (Neurog2 Synthetic, Mouse)
UseAAV and CRISPRTagsVP64Mutationdead Cas9Available SinceSept. 22, 2018AvailabilityAcademic Institutions and Nonprofits only -
pEN_TT 3xFLAG-MAVS-Ala271
Plasmid#158631PurposeGateway entry vector for an inducible 3xFLAG-tagged MAVS mutantDepositorInsertMAVS (MAVS Human)
UseGateway entry vectorTags3XFLAGMutationQ271A please see depositor comments belowAvailable SinceFeb. 19, 2021AvailabilityAcademic Institutions and Nonprofits only -
pSLIK 3xFLAG-MAVS-Ala271 hygro
Plasmid#158637PurposeLentiviral expression vector for an inducible 3xFLAG-tagged MAVS mutant constructDepositorAvailable SinceNov. 5, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSLIK 3xFLAG-MAVS-Gln93,Ala271 hygro
Plasmid#158638PurposeLentiviral expression vector for an inducible 3xFLAG-tagged MAVS mutant constructDepositorAvailable SinceOct. 1, 2020AvailabilityAcademic Institutions and Nonprofits only -
pEN_TT 3xFLAG-MAVS-Gln93,Ala271
Plasmid#158632PurposeGateway entry vector for an inducible 3xFLAG-tagged MAVS mutantDepositorAvailable SinceSept. 23, 2020AvailabilityAcademic Institutions and Nonprofits only -
pEN_TT 3xFLAG-MAVS-Ala148,Ala271
Plasmid#158633PurposeGateway entry vector for an inducible 3xFLAG-tagged MAVS mutantDepositorAvailable SinceSept. 23, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSLIK 3xFLAG-MAVS-Ala148,Ala271 hygro
Plasmid#158639PurposeLentiviral expression vector for an inducible 3xFLAG-tagged MAVS mutant constructDepositorAvailable SinceSept. 23, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSLIK 3xFLAG-MAVS-Ala148 hygro
Plasmid#158636PurposeLentiviral expression vector for an inducible 3xFLAG-tagged MAVS mutant constructDepositorAvailable SinceSept. 18, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSLIK 3xFLAG-MAVS-Gln93 hygro
Plasmid#158635PurposeLentiviral expression vector for an inducible 3xFLAG-tagged MAVS mutant constructDepositorAvailable SinceSept. 18, 2020AvailabilityAcademic Institutions and Nonprofits only -
N-Terminal Split Cas9 with GyrA intein
Plasmid#58693PurposeExpresses truncated N-terminal SpCas9 domain fused to a GyrA intein, flanked by ITRs for AAV packaging. Combine with C-Terminal Split Cas9 Gyra Intein for full length SpCas9 productionDepositorInsertHumanized N-Terminal S. pyogenes Cas9 with GyrA Nsplit Intein
UseAAV and CRISPRTags3xFlag, GyrA Nsplit Intein, and NLSExpressionMammalianPromoterCBhAvailable SinceJuly 6, 2015AvailabilityAcademic Institutions and Nonprofits only -
pHLS-EF1a-FRB-SpCas9-A
Plasmid#138477PurposeExpresses FRB fused SpCas9 for NanoMEDIC packaging.DepositorInsertSpCas9, human codon optimized
UseCRISPRTags3x HA tag and FRBExpressionMammalianAvailable SinceMarch 23, 2020AvailabilityAcademic Institutions and Nonprofits only -
pET30-2-PSAT1
Plasmid#83908Purposestable overexpressionDepositorInsertphosphoserine aminotransferase 1 (PSAT1 Human)
Tags6x His tagsExpressionBacterialPromoterT7Available SinceOct. 21, 2016AvailabilityAcademic Institutions and Nonprofits only -
pAAV-SCP1-dSa VPR mini.-2X snRP-1 Actc1
Plasmid#99690PurposeExpresses dSa Cas9 fused to optimized combination of truncated activation domains from SCP1 promoter with dual snRP1 poly adenylation signal, and Sa sgRNA for Actc1, vector allows for strong activation of mouse Actc1, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Actc1 (gRNA sequence: GCCATTCTTGGAGCCAAGGG ) (Actc1 Synthetic, Mouse)
UseAAV and CRISPRTagsVPR miniMutationdead Cas9Available SinceSept. 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-SCP1-dSa VPR mini.-2X snRP-1 Neurog2
Plasmid#99694PurposeExpresses dSa Cas9 fused to optimized combination of truncated activation domains from SCP1 promoter with dual snRP1 poly adenylation signal, and Sa sgRNA for Actc1, vector allows for strong activation of mouse Actc1, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Actc1 (gRNA: GGTATATAAGGGGTTTTAAG) (Actc1 Synthetic, Mouse)
UseAAV and CRISPRTagsVPR miniMutationdead Cas9Available SinceJan. 16, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLJM5-mSHMT2
Plasmid#83905Purposestable overexpressionDepositorInsertSerine hydroxymethyltransferase 2 (Shmt2 Mouse)
UseLentiviralExpressionMammalianPromoterCMVAvailable SinceOct. 21, 2016AvailabilityAcademic Institutions and Nonprofits only -
pET30-2-PSPH
Plasmid#83909Purposestable overexpressionDepositorAvailable SinceOct. 21, 2016AvailabilityAcademic Institutions and Nonprofits only -
MSP573
Plasmid#98796PurposeExpression VectorDepositorInsertpET28 MBP-ENLYFQS-TEV WT
ExpressionBacterialMutationNoneAvailable SinceOct. 20, 2017AvailabilityAcademic Institutions and Nonprofits only -
MSP574
Plasmid#98807PurposeExpression VectorDepositorInsertpET28 MBP-ENLYFQS-GST
ExpressionBacterialMutationNoneAvailable SinceOct. 20, 2017AvailabilityAcademic Institutions and Nonprofits only -
MSP578
Plasmid#98808PurposeExpression VectorDepositorInsertpET28 MBP-HNLYFQS-GST
ExpressionBacterialMutationNoneAvailable SinceOct. 20, 2017AvailabilityAcademic Institutions and Nonprofits only -
MSP808
Plasmid#98812PurposeExpression VectorDepositorInsertpET28 MBP-HNLYGHS-GST
ExpressionBacterialMutationNoneAvailable SinceOct. 20, 2017AvailabilityAcademic Institutions and Nonprofits only