We narrowed to 32,958 results for: AGA
-
Plasmid#68820PurposemCherry tagged Geph for mammalian expressionDepositorInsertGephyrin (Gphn Rat)
TagsmCherryExpressionMammalianMutationsilent mutations on internal EcoRI site. Gephyrin…PromoterCMVAvailable SinceSept. 15, 2015AvailabilityAcademic Institutions and Nonprofits only -
pCW-HA-hRb-delta-CDK-T373D-S608D-S612D-puro
Plasmid#212675PurposeExpress tagged hRb phosphosite mutantDepositorInsertRb (RB1 Human)
UseLentiviralTagsHAMutation15 CDK phospho-sites are mutated to alanines, and…PromoterTREAvailable SinceAug. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCW-HA-hRb-delta-CDK-T373D-S608D-S612D-puro
Plasmid#212675PurposeExpress tagged hRb phosphosite mutantDepositorInsertRb (RB1 Human)
UseLentiviralTagsHAMutation15 CDK phospho-sites are mutated to alanines, and…PromoterTREAvailable SinceAug. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pX335-NQL002-WAPL-sgRNA1
Plasmid#175550PurposeFor transient expression of spCas9-nickase and one sgRNA targeting the mouse WAPL locus. Use together with pX335-NQL003-WAPL-sgRNA2 targeting construct.DepositorInsertspCas9-nickase and sgRNA against mouse WAPL STOP Codon
UseMouse TargetingExpressionMammalianAvailable SinceNov. 5, 2021AvailabilityAcademic Institutions and Nonprofits only -
pX335-NQL002-WAPL-sgRNA1
Plasmid#175550PurposeFor transient expression of spCas9-nickase and one sgRNA targeting the mouse WAPL locus. Use together with pX335-NQL003-WAPL-sgRNA2 targeting construct.DepositorInsertspCas9-nickase and sgRNA against mouse WAPL STOP Codon
UseMouse TargetingExpressionMammalianAvailable SinceNov. 5, 2021AvailabilityAcademic Institutions and Nonprofits only -
pUDE710
Plasmid#103020Purposeexpression of a Cpf1 programming crRNA targeting ADE2 and HIS4 (crADE2-3 crHIS4-4.S)DepositorAvailable SinceDec. 1, 2017AvailabilityAcademic Institutions and Nonprofits only -
pUDE710
Plasmid#103020Purposeexpression of a Cpf1 programming crRNA targeting ADE2 and HIS4 (crADE2-3 crHIS4-4.S)DepositorAvailable SinceDec. 1, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCR3-FLAG-Gephyrin GC
Plasmid#68818PurposeFlag tagged mammalian expression of GC domainDepositorAvailable SinceAug. 28, 2015AvailabilityAcademic Institutions and Nonprofits only -
pCR3-FLAG-Gephyrin GC
Plasmid#68818PurposeFlag tagged mammalian expression of GC domainDepositorAvailable SinceAug. 28, 2015AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-HIS3b
Plasmid#87402PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting HIS3b sequence AATATAGAGTGTACTAGAGG in yeast chromosome 15.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting HIS3b
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only