We narrowed to 14,588 results for: transfer
-
Plasmid#89061PurposeAAV-gRNA targeting the murine Ldlr geneDepositorInsertEmGFP
UseAAV and CRISPRExpressionMammalianPromoterChicken beta actin with partial CMV enhancerAvailable SinceApril 11, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Ef1a-DIO-Egr3-EYFP-WPRE
Plasmid#186417PurposeOverexpression of Egr3 transcript variant 1 CDS under EF-1α promoterDepositorAvailable SinceJuly 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-C-intein-C-spC9-H840A-N863A-2xNLS-hGH
Plasmid#112211PurposeTargeted DNA methylationDepositorInsertC-terminus of dCas9
UseAAVMutationD10AAvailable SinceOct. 30, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAC8_PH-6His-Nter-GWs-Lox (VE5587)
Plasmid#163768PurposeTransfer vector for gene expression to generate recombinant baculoviruses by homologous recombination. Contains expression cassette with an N-ter 6 His tag under the pH promoter.DepositorInsertN-terminal 6His tag
Tags6 His TagExpressionInsectPromoterPHAvailable SinceDec. 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAC8_MF-PH-10His-Cter (VE5631)
Plasmid#161802PurposeTransfer vector for multigene expression to generate recombinant baculoviruses by homologous recombination. Contains a p10/pH dual expression cassette with an C-ter10His tag under the p10 promoter.DepositorInsertC-terminal 10 His tag
Tags10 HisExpressionInsectPromoterp10Available SinceDec. 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAC8_MF-P10-mCherry-pH-3C-TwinStrep (VE5621)
Plasmid#139770PurposeTransfer vector for multigene expression to generate recombinant baculoviruses by homologous recombination. Contains a p10/pH dual expression cassette with a C-ter TwinStrep tag under the PH promoter.DepositorInsertC-terminal TwinStrep tag
Tags3C - TwinStrep tagPromoterPHAvailable SinceDec. 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAC8_MF-p10-10His-Cter (VE5742)
Plasmid#139776PurposeTransfer vector for multigene expression to generate recombinant baculoviruses by homologous recombination. Contains a p10/pH dual expression cassette with an C-ter10His tag under the pH promoter.DepositorInsertC-terminal 10His tag
Tags10 HisExpressionInsectPromoterPHAvailable SinceDec. 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAC8_MF-p10-Flag-Cter(VE5738)
Plasmid#161798PurposeTransfer vector for multigene expression to generate recombinant baculoviruses by homologous recombination. Contains a p10/pH dual expression cassette with an C-ter Flag tag under the p10 promoter.DepositorInsertC-terminal Flag tag
TagsFlagExpressionInsectPromoterp10Available SinceMay 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAC8_MF-pH-Flag-Cter (VE5739)
Plasmid#161799PurposeTransfer vector for multigene expression to generate recombinant baculoviruses by homologous recombination. Contains a p10/pH dual expression cassette with an C-ter Flag tag under the pH promoter.DepositorInsertC-terminal Flag tag
TagsFlagExpressionInsectPromoterPHAvailable SinceMay 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAC8_MF-PH-HA-Nter-P10-mCherry (VE5740)
Plasmid#161800PurposeTransfer vector for multigene expression to generate recombinant baculoviruses by homologous recombination. Contains a p10/pH dual expression cassette with a N-ter HA tag under the pH promoter.DepositorInsertN-terminal HA tag
TagsHAExpressionInsectPromoterPHAvailable SinceMay 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAC8_PH-10His-Nter-GWs-Lox (VE5588)
Plasmid#161806PurposeTransfer vector for gene expression to generate recombinant baculoviruses by homologous recombination. Contains expression cassette with an N-ter 10 His tag under the pH promoter.DepositorInsertN-terminal 10His tag
Tags10 HisExpressionInsectPromoterPHAvailable SinceMay 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAC8_MF-PH-Flag-Nter (VE5627)
Plasmid#139773PurposeTransfer vector for multigene expression to generate recombinant baculoviruses by homologous recombination. Contains a p10/pH dual expression cassette with an N-ter Flag tag under the pH promoter.DepositorInsertN-terminal Flag tag
TagsFlagPromoterPHAvailable SinceMay 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAC8_MF-PH-HA-Cter (VE5629)
Plasmid#139775PurposeTransfer vector for multigene expression to generate recombinant baculoviruses by homologous recombination. Contains a p10/pH dual expression cassette with a C-ter HA tag under the pH promoter.DepositorInsertC-terminal Hemaglutinine tag
TagsHAPromoterPHAvailable SinceMay 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAC8_MF-PH-6His-Cter (VE5630)
Plasmid#139777PurposeTransfer vector for multigene expression to generate recombinant baculoviruses by homologous recombination. Contains a p10/pH dual expression cassette with an C-ter6His tag under the pH promoter.DepositorInsertC-terminal 6His tag
Tags6 HisExpressionInsectPromoterPHAvailable SinceMay 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAC8_MF-PH-c-Myc-Cter (VE5632)
Plasmid#139778PurposeTransfer vector for multigene expression to generate recombinant baculoviruses by homologous recombination. Contains a p10/pH dual expression cassette with a C-ter C-Myc tag under the pH promoter.DepositorInsertC-terminal C-Myc tag
Tagsc-MycExpressionInsectPromoterPHAvailable SinceMay 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAC8_MF-p10-mCh PH-mCh (VE5625)
Plasmid#139769PurposeTransfer vector for multigene expression to generate recombinant baculoviruses by homologous recombination. Contains a p10/pH dual expression cassette with an mCherry cDNA under each promoter.DepositorInsertmCherry fluorescent protein
ExpressionInsectPromoterPH or p10Available SinceMay 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAC8_MF-PH-3C-10His-Cter (VE5622)
Plasmid#139771PurposeTransfer vector for multigene expression to generate recombinant baculoviruses by homologous recombination. Contains a p10/pH dual expression cassette with a C-ter 10-His tag under the pH promoter.DepositorInsertC-terminal 10-His tag
Tags3C - 10HisPromoterPHAvailable SinceMay 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAVsc.U6-sgFah.CMV/CB-EGFP
Plasmid#121508PurposeExpresses sgRNA targeting mouse Fah intron 7 (sgFah).DepositorInsertsgFah
UseAAVExpressionMammalianPromoterU6Available SinceFeb. 5, 2019AvailabilityAcademic Institutions and Nonprofits only -
pEMS2116
Plasmid#49141PurposeThe plasmid contains the Pleaides (Ple) MiniPromoter Ple155 derived from the human PCP2 gene and designed for expression in ON Bipolar cells of the retina.DepositorInsertssAAV-Ple155-emGFP
UseAAVExpressionMammalianPromoterMiniPromoter Ple155 from the human PCP2 geneAvailable SinceMay 10, 2016AvailabilityIndustry, Academic Institutions, and Nonprofits -
pGW05 AAV-CRISPRa base vector pAAV-OE_U6-Lib(MS2)-EF1a-MPH-sPA
Plasmid#192159PurposeAAV-CRISPRa base vectorDepositorTypeEmpty backboneUseAAVMutationNAAvailable SinceNov. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-dSa VP64 Neurog2
Plasmid#99695PurposeExpresses dSa Cas9 fused to gold standard VP64 activator domain and Sa sgRNA for Neurog2 promoter, vector allows for activation of mouse Neurog2, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Neurog2 (gRNA: GGTATATAAGGGGTTTTAAG) (Neurog2 Synthetic, Mouse)
UseAAV and CRISPRTagsVP64Mutationdead Cas9Available SinceSept. 22, 2018AvailabilityAcademic Institutions and Nonprofits only -
pEMS1981
Plasmid#49112PurposeAAV plasmid with NR2E1 (Ple264) promoter driving expression of iCre.DepositorInsertssAAV-Ple264-iCre
UseAAVExpressionMammalianPromoterNR2E1Available SinceMay 10, 2016AvailabilityIndustry, Academic Institutions, and Nonprofits -
pAAV-CMV-dSa VP64 Actc1
Plasmid#99691PurposeExpresses dSa Cas9 fused to gold standard VP64 activator domain and Sa sgRNA for Actc1 promoter, vector allows for activation of mouse Actc1, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Actc1 (gRNA sequence: GCCATTCTTGGAGCCAAGGG) (Actc1 Synthetic, Mouse)
UseAAV and CRISPRTagsVP64Mutationdead Cas9Available SinceDec. 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV_ACTB CRISPIE
Plasmid#172853PurposeActb sgRNA & DRS-2 sgRNA expression under U6. CRISPIE donor mEGFP phase (0-0), excised by DRS-1 or DRS-2 (with SpCas9). Also expresses mRuby3 under the CBA promotor. See Zhong et al, eLife 2021.DepositorInsertsActb intron 1 sgRNA
DRS-2 sgRNA
CRISPIE designer exon (phase 0-0) encoding mEGFP
mRuby3
UseAAV and CRISPRExpressionMammalianAvailable SinceAug. 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
pEMS2049
Plasmid#79657PurposessAAV genome with Ple260 (PAX6 MiniPromoter) driving an emerald GFP (EmGFP) reporter. Contains WPREDepositorInsertssAAV Ple260-EmGFP WPRE
UseAAVPromoterPAX6 Retinal EnhancerAvailable SinceSept. 14, 2016AvailabilityAcademic Institutions and Nonprofits only -
RCAS-sgATG7
Plasmid#75228PurposeAn adaption on the RCAS/tv-a somatic cell gene transfer system, for use in combination with an existing Cas9 background in the cell/mouse of interest. Depositors: Jane Fraser/Noor GammohDepositorAvailable SinceJune 2, 2016AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Syn-2xLyn-ERex-Venus(Y145W)-bPAC(F198Y)
Plasmid#165492PurposeNeuronal expression of PACmn with dark Venus, a photoactivatable adenylyl cyclase derived from bPAC, membrane-anchored, no/reduced dark activityDepositorInsert2xLyn-ERex-Venus(Y145W)-bPAC(F198Y)
UseAAVTagsdarkVenusExpressionMammalianPromoterhSyn1Available SinceOct. 21, 2021AvailabilityAcademic Institutions and Nonprofits only -
pEMS2045
Plasmid#79653PurposessAAV genome with Ple256 (PAX6 MiniPromoter) driving an emerald GFP (EmGFP) reporter. Contains WPREDepositorInsertssAAV Ple256-EmGFP WPRE
UseAAVPromoterPAX6 enhancerAvailable SinceSept. 14, 2016AvailabilityAcademic Institutions and Nonprofits only -
pEMS2048
Plasmid#79656PurposessAAV genome with Ple259 (PAX6 MiniPromoter) driving an emerald GFP (EmGFP) reporter. Contains WPREDepositorInsertssAAV Ple259-EmGFP WPRE
UseAAVPromoterPAX6 MiniPromoterAvailable SinceSept. 14, 2016AvailabilityAcademic Institutions and Nonprofits only -
pAAV-RSV-GFP-U6-CCR5 gRNA (SpyCas9 scaffold)
Plasmid#113041PurposeAAV vector; encodes GFP as well as a U6-driven CCR5-targeting gRNA (SpyCas9 scaffold)DepositorInsertgRNA CCR5 (SpCas9 scaffold), co-expressed GFP (transfection marker)
UseAAV, CRISPR, and Synthetic BiologyExpressionMammalianAvailable SinceNov. 1, 2018AvailabilityAcademic Institutions and Nonprofits only