We narrowed to 41,124 results for: KAN
-
Plasmid#63714PurposeVoltage sensing domain of Ciona with the D136A/A154D/E183N/R223Q mutations fused to super ecliptic pHlorin A227DDepositorInsertCC2
TagsSuper ecliptic pHlorin A227DExpressionMammalianPromoterCMVAvailable SinceJuly 27, 2015AvailabilityAcademic Institutions and Nonprofits only -
CC3
Plasmid#63715PurposeVoltage sensing domain of Ciona with the G122A/D164A/D186A/R217Q/R229I mutations fused to super ecliptic pHlorin A227DDepositorInsertCC3
TagsSuper ecliptic pHlorin A227DExpressionMammalianPromoterCMVAvailable SinceJuly 16, 2015AvailabilityAcademic Institutions and Nonprofits only -
pGAD-hPLEKHM1
Plasmid#64145PurposeFor yeast two hybridDepositorAvailable SinceApril 17, 2015AvailabilityAcademic Institutions and Nonprofits only -
pGMCK-0X750-luxAB-DAS+4
Plasmid#49517PurposeKanamycin resistant; expresses luxAB-DAS+4 under the control of a promoter containing PtetO-4C5G; integrates into the mycobacteriophage att-L5 siteDepositorInsertP750-luxAB-DAS+4
TagsDAS+4 (AANDENYSENYADAS)ExpressionBacterialPromoterP750Available SinceJan. 17, 2014AvailabilityAcademic Institutions and Nonprofits only -
CFP-GAI(1-151)
Plasmid#37308DepositorAvailable SinceJune 19, 2012AvailabilityAcademic Institutions and Nonprofits only -
pCMV-Vamp2-pHluorin
Plasmid#190151PurposeExpresses (pH-sensitive) super ecliptic pHluorin-tagged mouse/rat Vamp2 for imaging exocytosisDepositorAvailable SinceDec. 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLX303
Plasmid#25897Purpose3rd generation lentiviral Gateway destination vector. Blasticidin selection.DepositorTypeEmpty backboneUseLentiviral; Gateway destination vectorExpressionMammalianAvailable SinceJuly 30, 2010AvailabilityAcademic Institutions and Nonprofits only -
pAAV_18xTEAD_luc2
Plasmid#173003Purposefirefly luciferase reporter vector with 18x clustered TEAD binding sitesDepositorInsert18xTEAD-luc2
UseAAV and LuciferaseExpressionMammalianAvailable SinceOct. 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
pUC19_msfGFP-NPM1-repair-template for U2OS
Plasmid#238246PurposeFor knock-in msfGFP to NPM1 locusDepositorInsertNPM1
UseCRISPRAvailable SinceJuly 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCDNA3_V5-APEX2-Sec61B
Plasmid#83412PurposeExpressed N-term tagged APEX2 on Sec61B in mammalian cellDepositorInsertV5-APEX2-Sec61B (SEC61B Human, Synthetic)
TagsAPEX2 and V5ExpressionMammalianPromoterCMV-FAvailable SinceMarch 9, 2017AvailabilityAcademic Institutions and Nonprofits only -
pJRH-1365 LV EF1a-CD28 IRES-EGFP
Plasmid#201921Purpose2nd generation lentiviral transfer plasmid for engineering cells to express human CD28DepositorAvailable SinceAug. 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
pYL156 (TRV RNA2)
Plasmid#148969PurposeModified Tobacco Rattle Virus RNA 2; used for virus induced gene silencing in plants along with pYL192 (TRV RNA1)DepositorInsertModified TRV RNA2
UseT-dna vectorMutationsee comments section belowAvailable SinceJune 23, 2020AvailabilityAcademic Institutions and Nonprofits only -
pK18msB
Plasmid#177839PurposePlasmid for gene replacement using kanamycin/sucrose selection/counterselection. Derived from pK18mobsacB but reduced in size.DepositorTypeEmpty backboneUseBacterial gene replacementAvailable SinceAug. 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pJRH-1345 U6-B2M sgRNA Gag-Cas9 v2
Plasmid#201916PurposeCas9-EDV production plasmid. Expresses the v2 Gag-Cas9 polypeptide (CAG promoter) and B2M sgRNA (human U6 promoter, 5’-GAGTAGCGCGAGCACAGCTA)DepositorInsertsGag-Cas9 v2
B2M sgRNA (Target-specific sequence: 5'- GAGTAGCGCGAGCACAGCTA)
ExpressionMammalianPromoterCAG and Human U6Available SinceAug. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3_NSlmb-vhhGFP4
Plasmid#35579DepositorInsertNSlmb-vhhGFP4 (slmb Fly)
ExpressionMammalianAvailable SinceApril 3, 2012AvailabilityAcademic Institutions and Nonprofits only -
pAAV mGAD65(delE1) GFP WPRE SV40pA
Plasmid#177316PurposeTo produce the AAV vector that expresses GFP under the control of the mGAD65 promoter. The mGAD65 promoter has highly specificity to GABAergic interneurons.DepositorInsertmGAD65(delE1) promoter, GABAergic interneurons specific promoter
UseAAVAvailable SinceDec. 13, 2021AvailabilityAcademic Institutions and Nonprofits only -
pDONR223_Luciferase
Plasmid#25894PurposeGateway entry vector containing Luciferase.DepositorInsertLuciferase
UseGateway entry vectorAvailable SinceJuly 30, 2010AvailabilityAcademic Institutions and Nonprofits only -
pJRH-1363 LV EF1a-CD19 IRES-EGFP
Plasmid#201919Purpose2nd generation lentiviral transfer plasmid for engineering cells to express human CD19DepositorAvailable SinceAug. 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
pDONR223_LacZ
Plasmid#25893PurposeGateway entry vector containing LacZ.DepositorInsertLacZ
UseGateway entry vectorAvailable SinceJuly 30, 2010AvailabilityAcademic Institutions and Nonprofits only -
pMpGWB119
Plasmid#68573PurposeGateway binary vector designed for transgenic research with Marchantia polymorpha as well as other plantsDepositorTypeEmpty backboneTagsModified EAR motif plant-specific repression doma…ExpressionPlantPromoterCauliflower mosaic virus 35S promoterAvailable SinceJune 24, 2016AvailabilityAcademic Institutions and Nonprofits only