We narrowed to 6,411 results for: kit
-
Plasmid#140650PurposeBRD4 tagging with mAIDDepositorInsertBRD4 (BRD4 Human)
UseCRISPRTagsExpressionMammalianMutationPromoterAvailable sinceNov. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
CMVp-dsRed2-Triplex-HHRibo-gRNA1-HDVRibo-pA
Plasmid#55201PurposePlasmid encoding the Ribozyme/gRNA architecture. This is a modified form of the original plasmid described in the paper (Construct 13). mKate2 was replaced with dsRed2 because of distribution issues.DepositorInsertdsRed2
UseSynthetic BiologyTagsExpressionMammalianMutationPromoterCMVAvailable sinceJune 16, 2014AvailabilityAcademic Institutions and Nonprofits only -
CTCF-C CRISPR
Plasmid#140647PurposeCTCF tagging CRISPRDepositorInsertCTCF (CTCF Human)
UseCRISPRTagsExpressionMammalianMutationPromoterAvailable sinceNov. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
pFUW-TetO-Fos
Plasmid#131593Purposedoxycycline-inducible expression of mouse c-Fos in mammalian cellsDepositorInsertFBJ osteosarcoma oncogene (Fos Mouse)
UseLentiviralTagsExpressionMammalianMutationPromoterTRE-mCMVAvailable sinceDec. 6, 2019AvailabilityAcademic Institutions and Nonprofits only -
BRD4-N CRISPR
Plasmid#140651PurposeBRD4 tagging CRISPRDepositorInsertBRD4 (BRD4 Human)
UseCRISPRTagsExpressionMammalianMutationPromoterAvailable sinceNov. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
CMVp-dsRed2-Triplex-28-gRNA3-28-gRNA4-28-gRNA5-28-gRNA6-28-pA
Plasmid#55202PurposePlasmid encoding multiplexed 4x gRNAs. This is a modified form of the original plasmid described in the paper (Construct 19). mKate2 was replaced with dsRed2 because of distribution issues.DepositorInsertdsRed2
UseSynthetic BiologyTagsExpressionMammalianMutationPromoterCMVAvailable sinceJune 16, 2014AvailabilityAcademic Institutions and Nonprofits only -
pAAV-VTKS1-hChR2-tBFP
Plasmid#178706PurposeAAV vector for transgene expression of hChR2-tBFP in neurons under the control of the hSyn1 promoter (Kugler et al 2003)DepositorInserthChR2-tBFP
UseAAVTagsExpressionMutationPromoterAvailable sinceMay 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(SMARCA2(47))-PGKpuro2ABFP-W
Plasmid#200510PurposeLentiviral vector expressing gRNA targeting human SMARCA2DepositorInsertSMARCA2(47) (SMARCA2 Human)
UseLentiviralTagsExpressionMutationPromoterAvailable sinceJan. 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
HAP40 1-371
Plasmid#124060PurposeBaculovirus expression vector for HAP40 protein (aa 1-371) in insect cellsDepositorInsertHAP40 (F8A1 Human)
UseBaculovirus expressionTags6x His and TEV cleavage siteExpressionMutationPromoterpolyhedrinAvailable sinceApril 24, 2019AvailabilityAcademic Institutions and Nonprofits only -
pJW2098
Plasmid#163094PurposeCRISPR repair template: add insertion site specific homology arms by PCR before insertionDepositorInsert30aa linker::mScarlet (dpi)::AID*::3xFLAG::10aa linker
UseCRISPRTagsExpressionWormMutationSilent mutations to remove piRNA sitesPromoterAvailable sinceJan. 5, 2021AvailabilityAcademic Institutions and Nonprofits only -
GABA(A) receptor subunit g2SE
Plasmid#49170PurposepHluorin-tagged GABA A receptor subunit (gamma 2) produces minimal fluorescence during trafficking and a robust fluorescent signal at the cell surfaceDepositorInsertGABA(A) receptor subunit gamma 2 (Gabrg2 Mouse)
UseTagsmyc, pHGFP (pHluorin), and thrombin cleavage site…ExpressionMammalianMutationPromoterCMVAvailable sinceDec. 10, 2013AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-CAN1y
Plasmid#87391PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting CAN1y sequence GATACGTTCTCTATGGAGGA in yeast chromosome 6.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting CAN1y
UseCRISPRTagsExpressionMutationPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pJW1821
Plasmid#163092PurposeCRISPR repair template: add insertion site specific homology arms by PCR before insertionDepositorInsertmScarlet^SEC (Lox511I)^::3xMyc
UseCRISPR and Cre/LoxTagsExpressionWormMutationPromoterAvailable sinceJan. 5, 2021AvailabilityAcademic Institutions and Nonprofits only -
GABA(A) receptor subunit B3SE
Plasmid#49171PurposepHluorin-tagged GABA A receptor subunit (beta 3) produces minimal fluorescence during trafficking and a robust fluorescent signal at the cell surfaceDepositorInsertGABA(A) receptor subunit beta 3 (Gabrb3 Mouse)
UseTagsmyc, pHGFP (pHluorin), and thrombin cleavage site…ExpressionMammalianMutationGTG (V) to TGC (C)PromoterCMVAvailable sinceDec. 10, 2013AvailabilityAcademic Institutions and Nonprofits only -
pYI2165
Plasmid#228347Purpose2,4-Diacetylphloroglucinol (DAPG)-regulatable ALX-0171 expressionDepositorInsertMFalpha(2xAdv)-LE-ALX-0171-3A-FLAG-His
UseAffinity Reagent/ AntibodyTagsAAA linker followed by FLAG-His6 and MF_ secretio…ExpressionYeastMutationPromoter2,4-Diacetylphloroglucinol-regulatable synthetic …Available sinceMarch 28, 2025AvailabilityAcademic Institutions and Nonprofits only -
CMVp-dCas9-3xNLS-VP64 (Construct 1)
Plasmid#55195PurposeExpresses taCas9 in Mammalian cells for transactivating endogenous and synthetic promoters. The backbone is a lentiviral vector.DepositorInsertdCas9
UseCRISPR and Synthetic BiologyTagsVP64ExpressionMammalianMutationPromoterCMV/hUBCAvailable sinceJune 16, 2014AvailabilityAcademic Institutions and Nonprofits only -
pJW2171
Plasmid#163095PurposeCRISPR repair template: add insertion site specific homology arms by PCR before insertionDepositorInsert30aa linker::mNeonGreen (dpi)::AID*::3xFLAG::10aa linker
UseCRISPRTagsExpressionWormMutationSilent mutations to remove piRNA sitesPromoterAvailable sinceJan. 5, 2021AvailabilityAcademic Institutions and Nonprofits only -
pOD1988-epiDEG
Plasmid#89357PurposeMosSCI targeting vector expressing a fusion between a GFP nanobody and an ubiquitin ligase adaptor ZIF-1 to degrade GFP tagged proteins. Expression is controlled by Pdpy-7 (epidermis specific).DepositorInsertvhhGFP4-ZIF-1 (zif-1 Nematode, Synthetic)
UseTargeting vector for mos1 transposon mediated sin…TagsvhhGFP4 (GFP nanobody)ExpressionMutationPromoterPdpy-7Available sinceJune 27, 2017AvailabilityAcademic Institutions and Nonprofits only -
p425_Cas9_gRNA_LEU_1014a
Plasmid#87407Purposep425_Cas9_gRNA-ARS1014a All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, LEU2 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1014a sequence TTATGTGCGTATTGCTTTCA in yeast chromosome 10.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS1014a
UseCRISPRTagsExpressionMutationPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-YPRCd15c
Plasmid#87404PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting YPRCd15c sequence AATCCGAACAACAGAGCATA in yeast chromosome 14.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting YPRCd15c
UseCRISPRTagsExpressionMutationPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only