We narrowed to 28,622 results for: sta
-
Plasmid#70719PurposeExpression vector for mCherry purificationDepositorInsertmCherry
Available SinceFeb. 2, 2016AvailabilityAcademic Institutions and Nonprofits only -
qTAG-N-Solo-mStayGold-GOLGA2
Plasmid#227325PurposeDonor template for mStayGold insertion into the N-terminus of the GOLGA2 locus. For Golgi visualization. To be co-transfected with sgRNA plasmid px330-PITCh-GOLGA2 (Addgene #207791)DepositorInsertGOLGA2 Homology Arms flanking a mStayGold Tag (GOLGA2 Human)
UseCRISPR; Donor templateExpressionMammalianPromoterPromoterlessAvailable SinceNov. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pHIV-IL13-CD8aStalk-PDGFR
Plasmid#240242PurposeLentiviral transfer plasmid encoding IL13 with CD8a stalk and PDGFR TM domainDepositorAvailable SinceJune 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
qTAG-N-Puro-mStayGold-LMNB1
Plasmid#227329PurposeDonor template for Puro-2A-mStayGold insertion into the N-terminus of the LMNB1 locus. For nuclear envelope visualization. To be co-transfected with sgRNA plasmid px330-PITCh-LMNB1 (Addgene #207770)DepositorInsertLMNB1 Homology Arms flanking a Puro-2A-mStayGold (LMNB1 Human)
UseCRISPR; Donor templateExpressionMammalianPromoterPromoterlessAvailable SinceNov. 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
pTH727-CEN-RLuc/staCFLuc
Plasmid#38211DepositorInsertsFirefly Luciferase
Renilla luciferase
ExpressionYeastMutationThe last three codons of the full-length Firefly …PromoterADH1 and TDH3 (=GPD)Available SinceOct. 22, 2012AvailabilityAcademic Institutions and Nonprofits only -
qTAG-N-Solo-mStayGold-PCNT
Plasmid#227285PurposeDonor template for mStayGold insertion into the N-terminus of the PCNT locus. For pericentriolar material visualization. To be co-transfected with sgRNA plasmid px330-PCNT (Addgene #227284)DepositorInsertPCNT Homology Arms flanking a mStayGold Tag (PCNT Human)
UseCRISPR; Donor templateExpressionMammalianPromoterPromoterlessAvailable SinceNov. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
AP1muA-mStayGold-polyA-Hygro HR
Plasmid#229679PurposeHomology repair plasmid for endogenous tagging of AP1muA at the C-terminus with monomeric StayGold. Contains a hygromycin resistance cassette for selection of edited cellsDepositorAvailable SinceJan. 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-h53BP1 (siRNA resistant)
Plasmid#110301PurposeMammalian expression of a EGFP-tagged full length human 53BP1 (resistant to siRNA targeting AGAACGAGGAGACGGTAATAGTGGG)DepositorInsertp53-binding protein 1 (TP53BP1 Human)
TagsEGFPExpressionMammalianMutationGAACGAGGA to GAGCGGGGCAvailable SinceMay 23, 2018AvailabilityAcademic Institutions and Nonprofits only -
siRNA-resistant mNG-ORP8
Plasmid#195170Purposemammalian expression of siRNA-resistant ORP8 tagged with mNeonGreenDepositorInsertORP8 (OSBPL8 Human)
TagsmNeonGreenExpressionMammalianMutationWobble mutations for siRNA resistance from K174 t…PromoterCMVAvailable SinceFeb. 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSIH1-puro-STAT3 shRNA
Plasmid#26596DepositorInsertSTAT3 shRNA (STAT3 Human)
UseLentiviral and RNAiAvailable SinceNov. 17, 2010AvailabilityAcademic Institutions and Nonprofits only -
pCMV-STAT6-IRES-Neo
Plasmid#35482DepositorAvailable SinceApril 20, 2012AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-FLAG-SBP-STAG2 (WT)
Plasmid#73963PurposeSTAG2 cDNA (CCDS43990) wild typeDepositorAvailable SinceMarch 7, 2016AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-Lck-mStayGold
Plasmid#234539Purposeto label the membrane of cells with a fluorescent protein (mStayGold)DepositorInsertLck-mStayGold(Ando)
UseAAVMutationNonePromoterShort CAGAvailable SinceJune 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLV 4xSTAR-mTagBFP2-blast
Plasmid#125239PurposeFluorescent reporter for intestinal stem cells through ASCL2 transcriptional activityDepositorInsertstem cell Ascl2 reporter, 4 repeats
UseLentiviralTagsmTagBFP2 (codon optimized)ExpressionMammalianAvailable SinceSept. 25, 2020AvailabilityAcademic Institutions and Nonprofits only -
Stat3-C Flag pRc/CMV
Plasmid#8722DepositorInsertStat3-C (Stat3 Mouse)
TagsFlagExpressionMammalianMutationA662C and N664C. Residues changed to Cys renders…Available SinceSept. 26, 2005AvailabilityAcademic Institutions and Nonprofits only -
pCAGGS-Stargazin-mEGFP-iLID
Plasmid#178523PurposeExpresses Stargazin-mEGFP-iLID in mammalian cellsDepositorInsertStargazin-mEGFP-iLID
ExpressionMammalianPromoterCAGAvailable SinceJan. 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAdCMV/V5-DEST-STAT3-3xFlag
Plasmid#99260PurposeAdenoviral vector encoding Flag-tagged murine STAT3DepositorInsertSignal transducer and activator of transcription 3 (Stat3 Mouse)
UseAdenoviralTags3x-FlagPromoterCMVAvailable SinceJan. 19, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCS2+StayGold-C Cloning Vector
Plasmid#208337PurposeTo express a protein of interest fused to the C-terminus of StayGold in mammalian cellsDepositorTypeEmpty backboneTagsStayGoldExpressionMammalianPromoterCMVAvailable SinceNov. 20, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCAG-RFP-p2a-postASAP
Plasmid#178793PurposeExpresses voltage sensor targeted to dendrites and spines along with RFPDepositorInsertFingR.PSD95, ASAP2f and TagRFP
TagsTagRFPExpressionMammalianMutationmutations in amino acids L146G, S147T N149R, S150…PromoterCAGAvailable SinceApril 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
qTAG-C-Solo-mStayGold-COX8A
Plasmid#227309PurposeDonor template for mStayGold insertion into the C-terminus of the COX8A locus. For mitochondria visualization. To be co-transfected with sgRNAplasmid px330-PITCh-COX8A (Addgene #227308)DepositorInsertCOX8A Homology Arms flanking a mStayGold Tag (COX8A Human)
UseCRISPR; Donor templateExpressionMammalianPromoterPromoterlessAvailable SinceNov. 25, 2024AvailabilityAcademic Institutions and Nonprofits only