We narrowed to 29,119 results for: sta
-
Plasmid#234539Purposeto label the membrane of cells with a fluorescent protein (mStayGold)DepositorInsertLck-mStayGold(Ando)
UseAAVMutationNonePromoterShort CAGAvailable SinceJune 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-10His-mStayGold (E138D)
Plasmid#211363PurposeMammalian expression of the bright and photostable monomeric StayGold fluorescent protein (E138D). Contains a N-terminal 10xHis tag.DepositorInsertmStayGold
Tags10xHis-tagExpressionMammalianMutationE138DPromoterCMVAvailable SinceDec. 20, 2023AvailabilityAcademic Institutions and Nonprofits only -
qTAG-N-Solo-mStayGold-ACTB
Plasmid#227326PurposeDonor template for mStayGold insertion into the N-terminus of the ACTB locus. For actin visualization. To be co-transfected with sgRNA plasmid px330-PITCh-ACTB (Addgene #207748)DepositorInsertACTB Homology Arms flanking a mStayGold Tag (ACTB Human)
UseCRISPR; Donor templateExpressionMammalianPromoterPromoterlessAvailable SinceNov. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pET21a(+)-Histag-mCherry (527)
Plasmid#70719PurposeExpression vector for mCherry purificationDepositorInsertmCherry
Available SinceFeb. 2, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCMV-STAT6-IRES-Neo
Plasmid#35482DepositorAvailable SinceApril 20, 2012AvailabilityAcademic Institutions and Nonprofits only -
qTAG-N-Solo-mStayGold-GOLGA2
Plasmid#227325PurposeDonor template for mStayGold insertion into the N-terminus of the GOLGA2 locus. For Golgi visualization. To be co-transfected with sgRNA plasmid px330-PITCh-GOLGA2 (Addgene #207791)DepositorInsertGOLGA2 Homology Arms flanking a mStayGold Tag (GOLGA2 Human)
UseCRISPR; Donor templateExpressionMammalianPromoterPromoterlessAvailable SinceNov. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
siRNA-resistant mNG-ORP8
Plasmid#195170Purposemammalian expression of siRNA-resistant ORP8 tagged with mNeonGreenDepositorInsertORP8 (OSBPL8 Human)
TagsmNeonGreenExpressionMammalianMutationWobble mutations for siRNA resistance from K174 t…PromoterCMVAvailable SinceFeb. 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-h53BP1 (siRNA resistant)
Plasmid#110301PurposeMammalian expression of a EGFP-tagged full length human 53BP1 (resistant to siRNA targeting AGAACGAGGAGACGGTAATAGTGGG)DepositorInsertp53-binding protein 1 (TP53BP1 Human)
TagsEGFPExpressionMammalianMutationGAACGAGGA to GAGCGGGGCAvailable SinceMay 23, 2018AvailabilityAcademic Institutions and Nonprofits only -
qTAG-C-mStayGold-EFS-Puro
Plasmid#227256PurposeEmpty C-terminus donor cassette. Integrate homology arms to target the C-terminus insertion of a mStayGold-EFS-Puro cassetteDepositorTypeEmpty backboneUseCRISPR; Donor cassetteExpressionMammalianAvailable SinceNov. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
qTAG-C-mStayGold-Puro-H2BC11
Plasmid#227332PurposeDonor template for mStayGold-2A-Puro insertion into the C-terminus of the H2BC11 locus. For nuclei visualization. To be co-transfected with sgRNA plasmid px330-PITCh-H2BC11 (Addgene #207755)DepositorInsertH2BC11 Homology Arms flanking a mStayGold-2A-Puro Cassette (H2BC11 Human)
UseCRISPR; Donor templateExpressionMammalianPromoterPromoterlessAvailable SinceNov. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
qTAG-C-Solo-mStayGold-TOMM20
Plasmid#227307PurposeDonor template for mStayGold insertion into the C-terminus of the TOMM20 locus. For mitochondria visualization. To be co-transfected with sgRNA plasmid px330-PITCh-TOMM20 (Addgene #207789)DepositorInsertTOMM20 Homology Arms flanking a mStayGold Tag (TOMM20 Human)
UseCRISPR; Donor templateExpressionMammalianPromoterPromoterlessAvailable SinceNov. 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
qTAG-C-mStayGold-Puro-PXN
Plasmid#227317PurposeDonor template for mStayGold-2A-Puro insertion into the C-terminus of the PXN locus. For focal adhesion visualization. To be co-transfected with sgRNA plasmid px330-PITCh-PXN (Addgene #227315)DepositorInsertPXN Homology Arms flanking a mStayGold-2A-Puro Cassette (PXN Human)
UseCRISPR; Donor templateExpressionMammalianPromoterPromoterlessAvailable SinceNov. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
Stat3 Flag pRc/CMV
Plasmid#8707DepositorAvailable SinceSept. 26, 2005AvailabilityAcademic Institutions and Nonprofits only -
pCAGGS-Stargazin-mEGFP-iLID
Plasmid#178523PurposeExpresses Stargazin-mEGFP-iLID in mammalian cellsDepositorInsertStargazin-mEGFP-iLID
ExpressionMammalianPromoterCAGAvailable SinceJan. 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
qTAG-N-Solo-mStayGold-CENPA
Plasmid#227283PurposeDonor template for mStayGold insertion into the N-terminus of the CENPA locus. For centromere visualization. To be co-transfected with sgRNA plasmid px330-CENPA (Addgene #227282)DepositorInsertCENPA Homology Arms flanking a mStayGold Tag (CENPA Human)
UseCRISPR; Donor templateExpressionMammalianPromoterPromoterlessAvailable SinceNov. 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMK390(Stag-3FLAG-BSD)
Plasmid#121191PurposeC-terminal taggingDepositorInsertStag-3FLAG-BSD
UseCRISPRAvailable SinceFeb. 13, 2019AvailabilityAcademic Institutions and Nonprofits only -
qTAG-C-mStayGold-EFS-Blast
Plasmid#227257PurposeEmpty C-terminus donor cassette. Integrate homology arms to target the C-terminus insertion of a mStayGold-EFS-Blast cassetteDepositorTypeEmpty backboneUseCRISPR; Donor cassetteExpressionMammalianAvailable SinceNov. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSIH1-puro-STAT3 shRNA
Plasmid#26596DepositorInsertSTAT3 shRNA (STAT3 Human)
UseLentiviral and RNAiAvailable SinceNov. 17, 2010AvailabilityAcademic Institutions and Nonprofits only -
AP1muA-mStayGold-polyA-Hygro HR
Plasmid#229679PurposeHomology repair plasmid for endogenous tagging of AP1muA at the C-terminus with monomeric StayGold. Contains a hygromycin resistance cassette for selection of edited cellsDepositorAvailable SinceJan. 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
FLAG-PPP2R5E siRNA-resistant
Plasmid#120861Purposeexpresses dox-inducible PPP2R5E resistant to siRNA pool 2 used in manuscriptDepositorInsertPPP2R5E (PPP2R5E Human)
TagsFLAGExpressionMammalianMutationsilent mutation at aa 282-284 in PPP2RE to genera…Available SinceFeb. 7, 2019AvailabilityAcademic Institutions and Nonprofits only