We narrowed to 22,885 results for: Sis;
-
Plasmid#86164PurposeSOBIR1 split YFPDepositorAvailable SinceJuly 6, 2017AvailabilityAcademic Institutions and Nonprofits only
-
p35S::SISOBIR1-YFPn
Plasmid#86163PurposeSOBIR1 split YFPDepositorInsertSOBIR1
UseTagsYFPnExpressionPlantMutationPromoter35SAvailable SinceJan. 4, 2017AvailabilityAcademic Institutions and Nonprofits only -
CpcB-Picea-sitchensisPHLS_CpcA
Plasmid#74001PurposeExpresses the Picea sitchensis PHLS as a fusion with the CpcB protein plus the CmR cassete in SynechocystisDepositorInsertPHLS and CmR
UseTagsExpressionMutationPromotercpcAvailable SinceMarch 11, 2016AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5FRT/TO-GFP-I3(resist)
Plasmid#61400PurposeExpresses GFP-tagged Inhibitor-3 resistant to I3 S2 siRNA in mammalian cellsDepositorInsertInhibitor-3 (PPP1R11 Human)
UseTagsGFPExpressionMammalianMutationsilent mutations of bases C183T T192C T189CPromoterCMVAvailable SinceSept. 25, 2015AvailabilityAcademic Institutions and Nonprofits only -
mCRISPRi-v2, Stress and Proteostasis (m3), top 5 sgRNAs/gene
Pooled Library#83991PurposeMouse CRISPRi Pooled Library targeting stress and proteostasis genesDepositorAvailable SinceJan. 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
mCRISPRa-v2, Stress and Proteostasis (m3), top 5 sgRNAs/gene
Pooled Library#84000PurposeMouse CRISPRi Pooled Library targeting stress and proteostasis genesDepositorAvailable SinceJan. 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
hCRISPRa-v2, Cancer and Apoptosis (h2), top 5 sgRNAs/gene
Pooled Library#83981PurposeHuman CRISPRa Pooled Library targeting cancer and apoptosis genesDepositorAvailable SinceJan. 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
mCRISPRi-v2, Cancer and Apoptosis (m2), top 5 sgRNAs/gene
Pooled Library#83990PurposeMouse CRISPRi Pooled Library targeting cancer and apoptosis genesDepositorAvailable SinceJan. 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
mCRISPRa-v2, Cancer and Apoptosis (m2), top 5 sgRNAs/gene
Pooled Library#83999PurposeMouse CRISPRa Pooled Library targeting cancer and apoptosis genesDepositorAvailable SinceJan. 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
hCRISPRi-v2, Cancer and Apoptosis (h2), top 5 sgRNAs/gene
Pooled Library#83972PurposeHuman CRISPRi Pooled Library targeting cancer and apoptosis genesDepositorAvailable SinceDec. 14, 2016AvailabilityAcademic Institutions and Nonprofits only -
hCRISPRa-v2, Stress and Proteostasis (h3), top 5 sgRNAs/gene
Pooled Library#83982PurposeHuman CRISPRa Pooled Library targeting stress and proteostasis genesDepositorAvailable SinceJan. 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
hCRISPRi-v2, Stress and Proteostasis (h3), top 5 sgRNAs/gene
Pooled Library#83973PurposeHuman CRISPRi Pooled Library targeting stress and proteostasis genesDepositorAvailable SinceDec. 14, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCMV-Rep78/68 Scanning Saturation Mutagenesis (SSM)
Pooled Library#198050PurposeBy supplying an AAV cap gene of interest in trans, researchers can use this library to investigate the effects of rep mutations on production of a wide range of AAV capsid serotypesDepositorExpressionMammalianUseAAVAvailable SinceMay 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
DHFR Saturation Mutagenesis Library - Q33S TYMS
Pooled Library#1000000196DepositorAvailable SinceMay 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
DHFR Saturation Mutagenesis Library - R166Q TYMS
Pooled Library#1000000195DepositorAvailable SinceMay 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
siRNA-resistant mNG-ORP8
Plasmid#195170Purposemammalian expression of siRNA-resistant ORP8 tagged with mNeonGreenDepositorInsertORP8 (OSBPL8 Human)
UseTagsmNeonGreenExpressionMammalianMutationWobble mutations for siRNA resistance from K174 t…PromoterCMVAvailable SinceFeb. 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
pR26 CAG AsiSI/MluI
Plasmid#74286PurposeGene targeting vector for the mouse Rosa26 locus, including a CAG promoter and loxP flanked stop cassette, for cloning into AsiSI or MluiDepositorInsertRosa26 5-homology region
UseTagsExpressionMutationPromoterAvailable SinceAug. 5, 2016AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-h53BP1 (siRNA resistant)
Plasmid#110301PurposeMammalian expression of a EGFP-tagged full length human 53BP1 (resistant to siRNA targeting AGAACGAGGAGACGGTAATAGTGGG)DepositorInsertp53-binding protein 1 (TP53BP1 Human)
UseTagsEGFPExpressionMammalianMutationGAACGAGGA to GAGCGGGGCPromoterAvailable SinceMay 23, 2018AvailabilityAcademic Institutions and Nonprofits only -
siRNA-resistant SigmaR1-mCherry
Plasmid#226567PurposeEncodes siRNA resistant SigmaR1 protein labeled with mCherryDepositorInsertSigmaR1 (Sigma-1 Receptor) (SIGMAR1 Human)
UseTagsmCherryExpressionMammalianMutationPromoterAvailable SinceNov. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
siRNA-resistant ABHD16A-Halo
Plasmid#195163Purposemammalian expression of siRNA-resistant ABHD16A tagged with Halo tagDepositorInsertABHD16A (ABHD16A Human)
UseTagsHalo tagExpressionMammalianMutationWobble mutations for siRNA resistance from L90 to…PromoterCMVAvailable SinceFeb. 7, 2023AvailabilityAcademic Institutions and Nonprofits only