We narrowed to 13,042 results for: HAL
-
Plasmid#15277DepositorInsertczgfp
ExpressionWormMutationleucine zipper fused to c-terminal half of gfpAvailable SinceJune 23, 2008AvailabilityAcademic Institutions and Nonprofits only -
pAAV-double floxed-eNpHR-EYFP-WPRE-pA
Plasmid#20949PurposeCre-activated AAV expression of halorhodopsin 2.0 (eNpHR) fused to EYFP for optogenetic inhibitionDepositorHas ServiceAAV9Inserthalorhodopsin
UseAAVTagsEYFPExpressionMammalianPromoterEF1alphaAvailable SinceMay 13, 2009AvailabilityAcademic Institutions and Nonprofits only -
GS1.2/PGC1
Plasmid#140416PurposemApple expression regulated by the A. thaliana UBQ10 promoter, mCitrine expression regulated by the A. thaliana PGC1 promoter. nourseothricin acetyl transferase selectable marker (nat)DepositorInsertsmApple
mCitrine
UseSynthetic BiologyExpressionPlantPromoterA. thaliana PGC1 and A. thaliana UBQ10Available SinceJuly 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
GS1.2/MYB60
Plasmid#140417PurposemApple expression regulated by the A. thaliana UBQ10 promoter, mCitrine expression regulated by the A. thaliana MYB60 promoter. nourseothricin acetyl transferase selectable marker (nat)DepositorInsertsmApple
mCitrine
UseSynthetic BiologyExpressionPlantPromoterA. thaliana MYB60 and A. thaliana UBQ10Available SinceJuly 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
GS1.2/CAB3
Plasmid#140419PurposemApple expression regulated by the A. thaliana UBQ10 promoter, mCitrine expression regulated by the A. thaliana CAB3 promoter. nourseothricin acetyl transferase selectable marker (nat)DepositorInsertsmApple
mCitrine
UseSynthetic BiologyExpressionPlantPromoterA. thaliana CAB3 and A. thaliana UBQ10Available SinceJuly 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
GS1.2/CURT1A
Plasmid#140420PurposemApple expression regulated by the A. thaliana UBQ10 promoter, mCitrine expression regulated by the A. thaliana CURT1A promoter. nourseothricin acetyl transferase selectable marker (nat)DepositorInsertsmApple
mCitrine
UseSynthetic BiologyExpressionPlantPromoterA. thaliana CURT1A and A. thaliana UBQ10Available SinceJuly 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
GS1.2/CURT1B
Plasmid#140421PurposemApple expression regulated by the A. thaliana UBQ10 promoter, mCitrine expression regulated by the A. thaliana CURT1B promoter. nourseothricin acetyl transferase selectable marker (nat)DepositorInsertsmApple
mCitrine
UseSynthetic BiologyExpressionPlantPromoterA. thaliana CURT1B and A. thaliana UBQ10Available SinceJuly 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
GS1.2/CURT1C
Plasmid#140422PurposemApple expression regulated by the A. thaliana UBQ10 promoter, mCitrine expression regulated by the A. thaliana CURT1C promoter. nourseothricin acetyl transferase selectable marker (nat)DepositorInsertsmApple
mCitrine
UseSynthetic BiologyExpressionPlantPromoterA. thaliana CURT1C and A. thaliana UBQ10Available SinceJuly 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
GS1.2/CURT1D
Plasmid#140423PurposemApple expression regulated by the A. thaliana UBQ10 promoter, mCitrine expression regulated by the A. thaliana CURT1D promoter. nourseothricin acetyl transferase selectable marker (nat)DepositorInsertsmApple
mCitrine
UseSynthetic BiologyExpressionPlantPromoterA. thaliana CURT1D and A. thaliana UBQ10Available SinceJuly 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pTRIPZ (M)-HT-Cbx2
Plasmid#82510PurposeExpresses Halotag-Cbx2 fusion proteins in mammalian cellsDepositorInsertChromobox Homolog 2 (CBX2 Human)
UseLentiviralTagsHaloTagExpressionMammalianPromoteraggcgtgtacggtgggaggcctatataagcagagctcgtttagtgaacc…Available SinceDec. 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
pAL750
Plasmid#200988PurposeInducible promoter Pxyl for Haloferax volcaniiDepositorTypeEmpty backboneUseExpression in haloarchaeaPromoterPfdx, PxylAvailable SinceMay 31, 2023AvailabilityAcademic Institutions and Nonprofits only -
pTRIPZ(M)-HT-Cbx8
Plasmid#82516PurposeLentivirus vector. Expresses halotag Cbx8fusion proteins in mammalian cells.DepositorInsertChromobox Homolog 8 (CBX8 Human)
UseLentiviralTagsHaloTagExpressionMammalianPromotercmvAvailable SinceDec. 20, 2016AvailabilityAcademic Institutions and Nonprofits only -
GS1.2/ADPGPP-350
Plasmid#140418PurposemApple expression regulated by the A. thaliana UBQ10 promoter, mCitrine expression regulated by a truncated A. thaliana ADPGPP promoter. nourseothricin acetyl transferase selectable marker (nat)DepositorInsertsmApple
mCitrine
UseSynthetic BiologyExpressionPlantPromoterA. thaliana UBQ10 and A. thaliana truncated ADPGPPAvailable SinceJuly 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pET28a-CdRdhA
Plasmid#217824PurposeExpresses N-His-CdRdhA in E. coliDepositorInsertN-His-CdRhdA
TagsHis6xExpressionBacterialPromoterT7Available SinceApril 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCDB179-RdhC1
Plasmid#217822PurposeExpresses HisSUMO-RdhC1 in E. coliDepositorInsertRdhC1
UseUnspecifiedTagsHis10xSUMOExpressionBacterialPromoterT7Available SinceApril 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCDB179-RdhF3
Plasmid#217823PurposeExpresses HisSUMO-RdhF3 in E. coliDepositorInsertRdhF3
TagsHis10xSUMOExpressionBacterialPromoterT7Available SinceApril 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
pET28a-DhFld
Plasmid#217821PurposeExpresses N-His-DhFld in E. coliDepositorInsertDhFld
TagsHis6xExpressionBacterialPromoterT7Available SinceApril 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
pTRIPZ (M)-HT-Cbx7
Plasmid#82515PurposeLentivirus vector. Expresses Halotag-Cbx7 fusion proteins in mammalian cells.DepositorInsertChromobox Homolog 7 (CBX7 Human)
UseLentiviralTagsHaloTagExpressionMammalianPromotercmvAvailable SinceDec. 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCasperAUG-Gal4-X
Plasmid#8378DepositorInsertYeast Gal4 (GAL4 fused to first ~30 amino acids of Drosophila ADH, Budding Yeast)
UseDrosophila p-element vectorAvailable SinceApril 4, 2006AvailabilityAcademic Institutions and Nonprofits only -
pTRIPZ (M)-HT-Cbx6
Plasmid#82514PurposeLentivirus vector. Expresses Halotag-Cbx6 fusion proteins in mammalian cells.DepositorInsertChromobox Homolog 6 (CBX6 Human)
UseLentiviralTagsHaloTagExpressionMammalianPromotercmvAvailable SinceDec. 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
pACYCDUET-StrepSUMO-DaPFOR
Plasmid#217819PurposeExpresses DaPFOR in E. coliDepositorInsertpACYCDUET-StrepSUMO-DaPFOR
TagsStrepSUMOExpressionBacterialPromoterT7Available SinceApril 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
Or46a-Gal4
Plasmid#63179PurposeExpresses Gal4 under control of the Drosophila melanogaster Or46a odorant receptor promoterDepositorInsertOr46a promoter
ExpressionInsectAvailable SinceApril 22, 2015AvailabilityAcademic Institutions and Nonprofits only -
pTRIPZ (M)-HT-Cbx4
Plasmid#82513PurposeLentivirus vector. Expresses Halotag-Cbx4 fusion proteins in mammalian cells.DepositorInsertChromobox Homolog 4 (Cbx4 Mouse)
UseLentiviralTagsHaloTagExpressionMammalianPromotercmvAvailable SinceDec. 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
pTW334e
Plasmid#237315Purposeexpresses A. thaliana Cpn60α Cpn60β Cpn20 Raf1 Raf2 RbcX Bsd2DepositorInsertA. thaliana Cpn60α Cpn60β Cpn20 Raf1 Raf2 RbcX Bsd2
ExpressionBacterialAvailable SinceMay 13, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMYO
Plasmid#34626DepositorInsertMyoglobin
Tags6xHISExpressionBacterialMutationcodon-optimizedPromoterlppAvailable SinceFeb. 2, 2012AvailabilityAcademic Institutions and Nonprofits only -
p415PGK1-AtMAX1(pYL759)
Plasmid#178289PurposeExpresses MAX1 from A. thaliana (AtMAX1) in Saccharomyces cerevisiae. Centromeric LEU, PPGK1-AtMAX1-Tpho5DepositorInsertAtMAX1
ExpressionYeastPromoterPGK1Available SinceSept. 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
pGEM-T Dmel Or67b
Plasmid#59672PurposeProbe for Drosophila melanogaster Or67b expressionDepositorInsertOr67b (Or67b Fly)
ExpressionBacterialAvailable SinceOct. 24, 2014AvailabilityAcademic Institutions and Nonprofits only -
pGEM-T Dmel Or82a
Plasmid#59678PurposeProbe for Drosophila melanogaster Or82a expressionDepositorInsertOr82a (Or82a Fly)
ExpressionBacterialAvailable SinceOct. 24, 2014AvailabilityAcademic Institutions and Nonprofits only -
pTRIPZ (M)-HT-CD(Cbx7)
Plasmid#82520PurposeLentivirus vector. Expresess mutant Halotag-CD-Cbx7 fusion proteins in mammalian cells. Express Chromodomain of Cbx7; amino acids 8–62.DepositorInsertChromobox Homolog 7 (CBX7 Human)
UseLentiviralTagsHaloTagExpressionMammalianMutationamino acids 8–62PromoterCMVAvailable SinceJan. 30, 2017AvailabilityAcademic Institutions and Nonprofits only -
p3387_KanR_4p
Plasmid#247310PurposeProduction of pinocembrin in Escherichia coli, cloned by BASIC assembly, based on 3387 in Carbonell et al. 2018DepositorInsertsAtCHI
AtCHS
Sc4CL
AtPAL
ExpressionBacterialPromoterPLacUV5Available SinceNov. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pB06_3360_6p
Plasmid#247311PurposeProduction of pinocembrin in Escherichia coli, cloned by BASIC assembly, based on 3360 in Carbonell et al. 2018DepositorInsertsAtCHI
AtCHS
Sc4CL
AtPAL
ExpressionBacterialPromoterPtrc with lac operator and noneAvailable SinceNov. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pEh_Cas6
Plasmid#178756PurposeExpression of E. haloalkaliphila type I-E cas6DepositorInsertE. haloalkaliphila type I-E cas6
ExpressionBacterialAvailable SinceMarch 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEh_Cas7
Plasmid#178757PurposeExpression of E. haloalkaliphila type I-E cas7DepositorInsertE. haloalkaliphila type I-E cas7
ExpressionBacterialAvailable SinceMarch 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEh_Cas8
Plasmid#178753PurposeExpression of E. haloalkaliphila type I-E cas8DepositorInsertE. haloalkaliphila type I-E cas8
ExpressionBacterialAvailable SinceMarch 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEh_Cse2
Plasmid#178754PurposeExpression of E. haloalkaliphila type I-E cse2DepositorInsertE. haloalkaliphila type I-E cse2
ExpressionBacterialAvailable SinceMarch 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEh_Cas5
Plasmid#178755PurposeExpression of E. haloalkaliphila type I-E cas5DepositorInsertE. haloalkaliphila type I-E cas5
ExpressionBacterialAvailable SinceMarch 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pGEM-T Dmel Or7a
Plasmid#59636PurposeProbe for Drosophila melanogaster Or7a expressionDepositorInsertOr7a (Or7a Fly)
ExpressionBacterialAvailable SinceOct. 24, 2014AvailabilityAcademic Institutions and Nonprofits only -
pDEST17-1ALigN
Plasmid#20024DepositorInsert1A Domain of DNA Ligase N
TagsHis tagExpressionBacterialAvailable SinceJan. 13, 2009AvailabilityAcademic Institutions and Nonprofits only -
pRL277
Plasmid#70255PurposesacB plasmid with polylinker; streptomycin/spectinomycin resistance: used as a conditionally lethal gene in Anabaena sp. strain PCC 7120 to select for double recombinants and to entrap insertion seq.DepositorTypeEmpty backboneUseConditionally lethalAvailable SinceNov. 18, 2015AvailabilityAcademic Institutions and Nonprofits only -
pRL271
Plasmid#70254PurposesacB plasmid with polylinker; chloramphenicol/erythromycin resistance: use as a conditionally lethal gene in Anabaena sp. strain PCC 7120 to select for double recombinants and to entrap insertion seq.DepositorTypeEmpty backboneUseConditionally lethalAvailable SinceNov. 17, 2015AvailabilityAcademic Institutions and Nonprofits only -
pET28a-At-TRL
Plasmid#32242DepositorInsertA. thaliana tRNA ligase (RNL Mustard Weed)
Tags6xHistidineExpressionBacterialPromoterT7 RNA PolmyeraseAvailable SinceJuly 5, 2013AvailabilityAcademic Institutions and Nonprofits only -
pTW334i
Plasmid#237319Purposeexpresses A. thaliana Cpn60α Cpn60β Cpn20 Raf2 RbcX Bsd2 N. tabacum Raf1DepositorInsertA. thaliana Cpn60α Cpn60β Cpn20 Raf2 RbcX Bsd2 N. tabacum Raf1
ExpressionBacterialAvailable SinceMay 13, 2025AvailabilityAcademic Institutions and Nonprofits only -
EMM65
Plasmid#49042PurposeBackbone contains SHD/C 0.5 Domain TALE N-terminal: TAL C-terminus: LSD1: Isoform 2DepositorTypeEmpty backboneUseTale lsd1 expression vectorTagsLSD1ExpressionMammalianPromoterEF1 alphaAvailable SinceOct. 31, 2013AvailabilityAcademic Institutions and Nonprofits only -
EMM67
Plasmid#49043PurposeBackbone contains SHD/G 0.5 Domain TALE N-terminal TALE C-terminus, LSD1: Isoform 2DepositorTypeEmpty backboneUseTale lsd1 expression vectorTagsLSD1ExpressionMammalianPromoterEF1 alphaAvailable SinceOct. 31, 2013AvailabilityAcademic Institutions and Nonprofits only -
VV001: WT Arch-3 in pET28b
Plasmid#58487PurposeExpresses WT Archaerhodopsin-3 (with 6x C-terminal His tag) in E. coliDepositorInsertArchaerhodopsin-3 (with C-terminal His tag)
ExpressionBacterialPromoterT7Available SinceJuly 23, 2014AvailabilityAcademic Institutions and Nonprofits only -
pGEM-T Dmel Or9a
Plasmid#59637PurposeProbe for Drosophila melanogaster Or9a expressionDepositorInsertOr9a (Or9a Fly)
ExpressionBacterialAvailable SinceOct. 24, 2014AvailabilityAcademic Institutions and Nonprofits only -
pGEM-T Dmel Or35a
Plasmid#59650PurposeProbe for Drosophila melanogaster Or35a expressionDepositorInsertOr35a (Or35a Fly)
ExpressionBacterialAvailable SinceOct. 24, 2014AvailabilityAcademic Institutions and Nonprofits only -
EMM71T
Plasmid#49044PurposeBackbone contains SHD/T 0.5 Domain TALE N-terminal TALE C-terminus, LSD1: Isoform 2DepositorTypeEmpty backboneUseTale lsd1 expression vectorExpressionMammalianPromoterEF1 alphaAvailable SinceNov. 5, 2013AvailabilityAcademic Institutions and Nonprofits only -
pGEM-T Dmel Or85c
Plasmid#59684PurposeProbe for Drosophila melanogaster Or85c expressionDepositorInsertOr85c (Or85c Fly)
ExpressionBacterialAvailable SinceOct. 24, 2014AvailabilityAcademic Institutions and Nonprofits only -
pGEM-T Dmel Or45a
Plasmid#59655PurposeProbe for Drosophila melanogaster Or45a expressionDepositorInsertOr45a (Or45a Fly)
ExpressionBacterialAvailable SinceOct. 24, 2014AvailabilityAcademic Institutions and Nonprofits only