We narrowed to 6,287 results for: tTA
-
Plasmid#215447PurposeGateway entry vector with integrin beta1 NPxY mutant (YYFF) tagged with mRuby2DepositorInsertITGB1 (ITGB1 Human)
UseGateway entry vectorTagsmRuby2MutationMutations in the NPxY sites Y783F, Y795F; Silent …PromoternoneAvailable SinceMay 29, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
pPB.DEST-ITGB1(YYFF)-mRuby2
Plasmid#215449PurposePiggybac expression vector with integrin beta1 NPxY mutant (YYFF) tagged with mRuby2DepositorInsertITGB1 (ITGB1 Human)
UseTransposon-based stable expressionTagsmRuby2ExpressionMammalianMutationMutations in the NPxY sites Y783F, Y795F; Silent …PromoterCAGAvailable SinceMay 29, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
sgMST1/2-1
Plasmid#229429Purposeknockout of MST1 and MST2DepositorUseCRISPR and LentiviralExpressionMammalianPromoterhU6;bU6;EFSAvailable SinceDec. 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
AAVS1-TRE3G-SOX2-3xHA-P2A-tagBFP
Plasmid#163701PurposeDox-inducible SOX2-3xHA HDR knock-in cassette into the AAVS1 locus with a tagBFP fluorescent marker linked by a self-cleaving P2A peptide.DepositorInsertsUseAAV and CRISPRTags3x-HA and P2A-tagBFPExpressionMammalianPromoterCAG and TRE3GAvailable SinceOct. 3, 2024AvailabilityAcademic Institutions and Nonprofits only -
Lenti-N1303K-ngRNA+14_EF1a-puroR
Plasmid#207359PurposeLentiviral transfer plasmid encoding hU6-driven expression of a ngRNA for correction of N1303K-CFTR via prime editing and EF1a-driven puromycin resistance gene.DepositorInsertN1303K-CFTR +14 ngRNA
UseLentiviralAvailable SinceApril 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(CXCR4-E2(38))-PGKpuro2ABFP-W
Plasmid#200481PurposeLentiviral vector expressing gRNA targeting human CXCR4-E2DepositorInsertCXCR4-E2(38) (CXCR4 Human)
UseLentiviralAvailable SinceApril 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(CXCR4-E4(56))-PGKpuro2ABFP-W
Plasmid#200484PurposeLentiviral vector expressing gRNA targeting human CXCR4-E4DepositorInsertCXCR4-E4(56) (CXCR4 Human)
UseLentiviralAvailable SinceJan. 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(CXCR4-SE(95))-PGKpuro2ABFP-W
Plasmid#200476PurposeLentiviral vector expressing gRNA targeting human CXCR4-SEDepositorInsertCXCR4-SE(95) (CXCR4 Human)
UseLentiviralAvailable SinceJan. 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(CXCR4-E4(56))-PGKpuro2AmCherry-W
Plasmid#210614PurposeLentiviral vector expressing gRNA targeting human CXCR4-E4DepositorInsertCXCR4-E4(56) (CXCR4 Human)
UseLentiviralAvailable SinceJan. 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(CXCR4-E3(45))-PGKpuro2ABFP-W
Plasmid#200482PurposeLentiviral vector expressing gRNA targeting human CXCR4-E3DepositorInsertCXCR4-E3(45) (CXCR4 Human)
UseLentiviralAvailable SinceJan. 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCDH-V1-rCD20-BSD
Plasmid#209752PurposeTo reconstitute CD20 expression with a specific mRNA isoform (variant 1) after CRISPR-Cas9-mediated knockout of CD20.DepositorInsertMS4A1 (MS4A1 Human)
UseLentiviralMutationThe CCTGGGGGGTCTTCTGATGATCC sequence within the C…Available SinceNov. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCDH-V2-rCD20-BSD
Plasmid#209753PurposeTo reconstitute CD20 expression with a specific mRNA isoform (variant 2) after CRISPR-Cas9-mediated knockout of CD20.DepositorInsertMS4A1 (MS4A1 Human)
UseLentiviralMutationThe CCTGGGGGGTCTTCTGATGATCC sequence within the C…Available SinceNov. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCDH-V3-rCD20-BSD
Plasmid#209754PurposeTo reconstitute CD20 expression with a specific mRNA isoform (variant 3) after CRISPR-Cas9-mediated knockout of CD20.DepositorInsertMS4A1 (MS4A1 Human)
UseLentiviralMutationThe CCTGGGGGGTCTTCTGATGATCC sequence within the C…Available SinceNov. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pKHH030_sgAMBRA1#1
Plasmid#174146PurposeLentiviral vector expressing a sgRNA against the human AMBRA1 geneDepositorAvailable SinceSept. 13, 2021AvailabilityAcademic Institutions and Nonprofits only -
miR3 HsATP10B
Plasmid#171824Purposetransfer plasmid for lentiviral vector production with miR for Hs ATP10BDepositorAvailable SinceJuly 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
px330-Kmt2c-2
Plasmid#162532PurposesgRNA targeting Kmt2cDepositorAvailable SinceFeb. 17, 2021AvailabilityAcademic Institutions and Nonprofits only -
px330-Kmt2b-2
Plasmid#162536PurposesgRNA targeting Kmt2bDepositorAvailable SinceFeb. 17, 2021AvailabilityAcademic Institutions and Nonprofits only -
px330-Alb-1
Plasmid#162544PurposesgRNA targeting AlbDepositorAvailable SinceFeb. 17, 2021AvailabilityAcademic Institutions and Nonprofits only -
pEN487 - Sororin-AID[71-114]-eGFP-FRT-Blast-FRT targeting conuct
Plasmid#156433PurposeTargeting vector to introduce an AID-eGFP cassette at the mouse Cdca5 (SORORIN) locus using BLASTICIDIN selection. Auxin-inducible degron system. Designed to be used with sgRNA GGGATGCCCGTCATTAAGTGDepositorAvailable SinceSept. 2, 2020AvailabilityAcademic Institutions and Nonprofits only -
pOTTC1388 - pAAV MANF gRNA A+B EF1a EGFP
Plasmid#113157PurposeAn AAV vector that expresses guide RNAs targeting rat MANF and expresses EGFP reporterDepositorInsertTwo gRNAs for rat MANF
UseAAV and CRISPRExpressionMammalianPromotermU6 and hU6Available SinceMarch 7, 2019AvailabilityAcademic Institutions and Nonprofits only