We narrowed to 21,460 results for: KIN
-
Plasmid#219745PurposeMoClo-compatible Level 0 promoterless vector encoding mutant of Neonothopanus nambi luciferase nnLuz_v4 codon-optimised for expression in Nicotiana benthamianaDepositorInsertmutant of fungal luciferase
UseLuciferase and Synthetic BiologyMutationI3S, N4T, F11L, I63T, T99P, T192S, A199PAvailable SinceOct. 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
pNK116
Plasmid#219742PurposeMoClo-compatible Level 0 promoterless vector encoding mutant of Neonothopanus nambi hispidin-3-hydroxylase nnH3H_v2 codon-optimised for expression in Nicotiana benthamianaDepositorInsertmutant of fungal hispidin-3-hydroxylase
UseSynthetic BiologyMutationD37E, V181I, S323M, M385KAvailable SinceJuly 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
nAChR beta2 CFP
Plasmid#15106DepositorAvailable SinceJune 8, 2007AvailabilityAcademic Institutions and Nonprofits only -
pDEST53-LRRK2-ROC
Plasmid#25053DepositorInsertLRRK2 (LRRK2 Human)
TagsGFPExpressionMammalianMutationContains only the ROC domain- aa 1333-1516Available SinceNov. 1, 2011AvailabilityAcademic Institutions and Nonprofits only -
pNK189
Plasmid#219743PurposeMoClo-compatible Level 0 promoterless vector encoding mutant of Neonothopanus nambi hispidin-3-hydroxylase nnH3H_v2 codon-optimised for expression in Homo sapiensDepositorInsertmutant of fungal hispidin-3-hydroxylase
UseSynthetic BiologyMutationD37E, V181I, S323M, M385KAvailable SinceJuly 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pNK4169
Plasmid#219744PurposeMoClo-compatible Level 0 promoterless vector encoding mutant of Neonothopanus nambi hispidin-3-hydroxylase nnH3H_v2 codon-optimised for expression in Pichia pastorisDepositorInsertmutant of fungal hispidin-3-hydroxylase
UseSynthetic BiologyMutationD37E, V181I, S323M, M385KAvailable SinceJuly 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
IL2-mCherry-rGBD in pmCherryN1
Plasmid#187286PurposeExpress IL2-Rhotekin GTPase-binding domain-mCherryDepositorTagsmCherryExpressionMammalianPromoterCMVAvailable SinceSept. 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
pNK3071
Plasmid#219755PurposeMoClo-compatible Level P vector for improved autonomous bioluminescence in plants encoding kanamycin resistance cassette, mcitHispS, NpgA, nnH3H_v2, nnLuz_v4 and nnCPH.DepositorInsertmcitHispS, NpgA, nnH3H_v2, nnLuz_v4 and nnCPH
ExpressionPlantAvailable SinceOct. 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
pNK497
Plasmid#219754PurposeMoClo-compatible Level P vector for improved autonomous bioluminescence in plants encoding kanamycin resistance cassette, nnHispS, NpgA, nnH3H_v2, nnLuz_v4 and nnCPH.DepositorInsertnnHispS, NpgA, nnH3H_v2, nnLuz_v4 and nnCPH
ExpressionPlantAvailable SinceJan. 21, 2025AvailabilityAcademic Institutions and Nonprofits only -
pOmnibac_ZZ_linker_K963_GFP_SNAP
Plasmid#159727PurposeExpresses kinesin-1 (amino acids 1-963) in Sf9 cells with a C-terminal GFP and SNAP tagDepositorInsertKIF5B (full length, 1-963 amino acids), K963 (KIF5B Human)
TagsGFP and SNAP tags and ZZ affinity tagExpressionInsectAvailable SinceJan. 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
pcDNA-EGFP MASTL E167D (siRNA resistant)
Plasmid#191013PurposeExpresses EGFP-tagged MASTL with E167D mutation and resistance to MASTL siRNA (ACGCCTTATTCTAGCAAATTA)DepositorInsertMicrotubule-associated serine/threonine kinase like (MASTL Human)
TagsEGFPExpressionMammalianMutationE167DAvailable SinceNov. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pOmnibac_ZZ_linker_K560_GFP_SNAP
Plasmid#159720PurposeExpresses kinesin-1 (amino acids 1-560) in Sf9 cells with a C-terminal GFP and SNAP tagDepositorInsertKIF5B (only amino acids 1-560), K560 (KIF5B Human)
TagsGFP and SNAP tags and ZZ affinity tagExpressionInsectMutationOnly amino acids 1-560Available SinceJan. 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
pNK845
Plasmid#219746PurposeMoClo-compatible Level 0 promoterless vector encoding mutant of Neonothopanus nambi luciferase nnLuz_v4 codon-optimised for expression in Pichia pastoris, Homo sapiensDepositorInsertmutant of fungal luciferase
UseLuciferase and Synthetic BiologyMutationI3S, N4T, F11L, I63T, T99P, T192S, A199PAvailable SinceJuly 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pOmnibac_ZZ_linker_K490_GFP_SNAP
Plasmid#159721PurposeExpresses kinesin-1 (amino acids 1-490) in Sf9 cells with a C-terminal GFP and SNAP tagDepositorInsertKIF5B (only amino acids 1-490), K490 (KIF5B Human)
TagsGFP and SNAP tags and ZZ affinity tagExpressionInsectMutationOnly amino acids (1-490)Available SinceJan. 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
TDP-REGv2 Triple Cryptic Cre recombinase in pTwist-CMV
Plasmid#216162PurposeExpresses Cre recombinase in cells lacking TDP-43 function. Note: It is not recommended to produce lentiviruses containing TDP-REG sequences – see Depositor CommentsDepositorInsertCre recombinase with N-terminal SV40 NLS and C-terminal c-Myc NLS
UseCre/LoxExpressionMammalianAvailable SinceJuly 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLL3.7-EF-EYFP-YAP1_delta5C-PolyA
Plasmid#112289PurposeFluorescently labels human YAP1-2gamma isoform (504 aa) delta5C mutant lacking the last five residues (FLTWL) in the PDZ binding domain at the N-terminus of the proteinDepositorInsertEYFP-YAP1 (YAP1 Human)
UseLentiviralMutationHuman YAP1-2gamma lacking the last 5 Amino acids …PromoterEF-1 alphaAvailable SinceMay 13, 2019AvailabilityAcademic Institutions and Nonprofits only -
J72008 bacterial strain with plasmid
Bacterial Strain#26187DepositorBacterial ResistanceAmpicillinAvailable SinceApril 10, 2012AvailabilityAcademic Institutions and Nonprofits only -
pDONR223-MAP3K12
Plasmid#23626DepositorInsertMAP3K12 (MAP3K12 Human)
UseGateway donor vectorAvailable SinceJuly 30, 2010AvailabilityAcademic Institutions and Nonprofits only -
pDONR223-MAP3K7
Plasmid#23693DepositorInsertMAP3K7 (MAP3K7 Human)
UseGateway donor vectorAvailable SinceJuly 30, 2010AvailabilityAcademic Institutions and Nonprofits only -
pWZL Neo Myr Flag MAP3K7
Plasmid#20520DepositorAvailable SinceOct. 27, 2009AvailabilityAcademic Institutions and Nonprofits only