We narrowed to 82,966 results for: Mycs
-
Plasmid#107931PurposeTRP1 based Yeast/E.coli shuttle vector designed to clone and express Cas9 programming spacerDepositorInsertgRNA-CAN1.Y, gRNA-ADE2.Y
UseCRISPRExpressionYeastAvailable SinceApril 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-R-RDS1a
Plasmid#87405Purposep426_Cas9_gRNA-RDS1a without the ribozyme All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting RDS1a sequence ATTCAATACGAAATGTGTGC in yeast chromosome 3.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting RDS1a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pROS11
Plasmid#107925PurposeamdS based Yeast/E.coli shuttle vector designed to clone and express Cas9 programming spacerDepositorInsertgRNA-CAN1.Y, gRNA-ADE2.Y
UseCRISPRExpressionYeastAvailable SinceApril 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPR - EGFP sgRNA 6
Plasmid#51765PurposeExpresses human codon-optimized Cas9 protein and puromycin resistance from EFS promoter and an EGFP targeting synthetic single-guide RNA (sgRNA) element from U6 promoter. Lentiviral backbone.DepositorInsertsCas9
Puromycin resistance
EGFP sgRNA 6
UseCRISPR and LentiviralExpressionMammalianPromoterEFS and U6Available SinceMarch 11, 2014AvailabilityAcademic Institutions and Nonprofits only -
pROS16
Plasmid#107930PurposeHIS3 based Yeast/E.coli shuttle vector designed to clone and express Cas9 programming spacerDepositorInsertgRNA-CAN1.Y, gRNA-ADE2.Y
UseCRISPRExpressionYeastAvailable SinceApril 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
his3MX6-ins3
Plasmid#195040PurposepFA6a derived selection cassette flanked with transcription terminators (tDEG1/tCYC1), allows genome modification without disruption of insertion neighboring genes by transcription interferenceDepositorInsertHis5+
UseYeast genomic targetingTagsS. cerevisiae DEG1 terminator, A. gossypii TEF pr…Available SinceFeb. 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
pROS15
Plasmid#107929Purposenat based Yeast/E.coli shuttle vector designed to clone and express Cas9 programming spacerDepositorInsertgRNA-CAN1.Y, gRNA-ADE2.Y
UseCRISPRExpressionYeastAvailable SinceJune 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
pROS14
Plasmid#107928PurposeLEU2 based Yeast/E.coli shuttle vector designed to clone and express Cas9 programming spacerDepositorInsertgRNA-CAN1.Y, gRNA-ADE2.Y
UseCRISPRExpressionYeastAvailable SinceApril 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCDNA5_FRB-pBirA-HA
Plasmid#83415Purposeproximity-directed biotin labeling on the FRB domain of mTOR in mammalian cellDepositorAvailable SinceMarch 9, 2017AvailabilityAcademic Institutions and Nonprofits only -
pUDP044
Plasmid#101168PurposepUDP004 expressing a polycistronic g-RNA array for Cas9 editing targeting the genes SeATF1 and SeATF2 and Spcas9D147Y P411T in S. pastorianus (HH-gRNASeATF1-HDV-linker-HH-gRNASeATF2-HDV)DepositorInsertpolycistronic HH-gRNA-HDV-HH-gRNA-HDV array targetting SeATF1 and 2 in S. pastorianus
UseCRISPRExpressionYeastPromoterScTDH3Available SinceDec. 4, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-R-ARS607c
Plasmid#87409Purposep426_Cas9_gRNA-ARS607c without ribozyme All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS607c sequence CTATTTTTGCTTTCTGCACA in yeast chromosome 6.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS607c
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCDNA3-2xMARS-PLD
Plasmid#205237PurposeExpresses two repeats of PLEKAH5 aa 143-271 (K163A and R164A) fused to phospholipase D from Streptomyces sp. PMFDepositorInsertsTagsNuclear Export Sequence and mCherryExpressionMammalianMutationamino acids 143-271 of PLEKHA5 (GenBank reference…PromoterCMVAvailable SinceJuly 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSCBE3-HF1
Plasmid#218156PurposeThis plasmid harbors the base editor SCBE3-HF1 along with an sgRNA cloning cassette, facilitating high-fidelity cytosine base editing in Streptomyces.DepositorInsertsscbe3-HF1
a programmable sgRNA cloning cassette
UseCRISPR; Sgrna transcriptionExpressionBacterialMutationMutations in the portion of SpCas9 : D10A / N497A…PromoterrpsL promoterAvailable SinceMay 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSCBE3-HF1-Hypa
Plasmid#218158PurposeThis plasmid harbors the base editor SCBE3-HF1-Hypa along with an sgRNA cloning cassette, facilitating high-fidelity cytosine base editing in Streptomyces.DepositorInsertsscbe3-HF1-Hypa
a programmable sgRNA cloning cassette
UseCRISPR; Sgrna transcriptionExpressionBacterialMutationMutations in the portion of SpCas9 : D10A / N497A…PromoterrpsL promoterAvailable SinceMay 13, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSCBE3-Hypa
Plasmid#218157PurposeThis plasmid harbors the base editor SCBE3-Hypa along with an sgRNA cloning cassette, facilitating high-fidelity cytosine base editing in Streptomyces.DepositorInsertsscbe3-Hypa
a programmable sgRNA cloning cassette
UseCRISPR; Sgrna transcriptionExpressionBacterialMutationMutations in the portion of SpCas9 : D10A / N692A…PromoterrpsL promoterAvailable SinceMay 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
pEFEX1-A2aGH
Plasmid#160543PurposepYES2 derivative reporter plasmid encoding Ashbya gossypii PTEF1-Saccharomyces cerevisiae FEX1-MFaT; as well as PGAL1-Homo sapiens ADORA2A-EGFP-10HIS-MFaT.DepositorInsertExpressionYeastMutationN/AAvailable SinceSept. 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEFEX2-A2aGH
Plasmid#160544PurposepYES2 derivative reporter plasmid encoding PPGI1-Saccharomyces cerevisiae FEX1-MFaT; as well as PGAL1-Homo sapiens ADORA2A-EGFP-10HIS-MFaT.DepositorInsertExpressionYeastMutationN/AAvailable SinceSept. 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEFEX3-A2aGH
Plasmid#160545PurposepYES2 derivative reporter plasmid encoding PREV1-Saccharomyces cerevisiae FEX1-MFaT; as well as PGAL1-Homo sapiens ADORA2A-EGFP-10HIS-MFaT.DepositorInsertExpressionYeastMutationN/AAvailable SinceSept. 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCFEX1-A2aGH
Plasmid#160546PurposepYC2/CT derivative reporter plasmid encoding Ashbya gossypii PTEF1-Saccharomyces cerevisiae FEX1-MFaT; as well as PGAL1-Homo sapiens ADORA2A-EGFP-10HIS-MFaT.DepositorInsertExpressionYeastMutationN/AAvailable SinceSept. 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCFEX2-A2aGH
Plasmid#160547PurposepYC2/CT derivative reporter plasmid encoding PPGI1-Saccharomyces cerevisiae FEX1-MFaT; as well as PGAL1-Homo sapiens ADORA2A-EGFP-10HIS-MFaT.DepositorInsertExpressionYeastMutationN/AAvailable SinceSept. 30, 2022AvailabilityAcademic Institutions and Nonprofits only