We narrowed to 6,947 results for: KIT;
-
Plasmid#140545PurposeDHC1 tagging CRISPRDepositorInsertDHC1 (DYNC1H1 Human)
UseCRISPRAvailable SinceNov. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSLPB2B-FKBP12_F36V-SpdCas9-KRAB-tagBFP-PGK-Blasticidin
Plasmid#187953PurposeFKBP12 (F36V mutant) degron-tagged dCas9-KRAB domain fused to tagBFP, expressed under EF1-alpha promoter in a piggyBac plasmid. Expresses Blasticidin resistance under PGK promoter.DepositorInsertFKBP12_F36V-SpdCas9-KRAB-tagBFP
UseCRISPR and Synthetic BiologyTagsGGSExpressionMammalianAvailable SinceOct. 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
pcDNA-FRT/T0-eGFPnls-53BP1 1220-1631 WT
Plasmid#60814Purposemammalian expression vectorDepositorAvailable SinceApril 10, 2015AvailabilityIndustry, Academic Institutions, and Nonprofits -
pOD2046-bwmDEG
Plasmid#89367PurposeMosSCI targeting vector expressing a fusion between a GFP nanobody and an ubiquitin ligase adaptor ZIF-1 to degrade GFP tagged proteins. Expression is controlled by Pmyo-3 (body wall muscle specific).DepositorInsertvhhGFP4-ZIF-1 (zif-1 Nematode, Synthetic)
UseTargeting vector for mos1 transposon mediated sin…TagsvhhGFP4 (GFP nanobody)PromoterPmyo-3Available SinceJune 27, 2017AvailabilityAcademic Institutions and Nonprofits only -
pJW1586
Plasmid#121057PurposemKate2^SEC^AID*::3xFLAG vector with ccdB sites for cloning homology arms.DepositorInsertmKate2-T^SEC^AID*::3xFlag
UseCRISPR and Cre/LoxTags3xFLAG, C. elegans codon optimized mKate2, and au…ExpressionWormAvailable SinceJune 7, 2019AvailabilityAcademic Institutions and Nonprofits only -
pOD2048-csnDEG
Plasmid#89368PurposeMosSCI targeting vector expressing a fusion between a GFP nanobody and ubiquitin ligase adaptor ZIF-1 to degrade GFP tagged proteins. Expression controlled by Posm-6 (ciliated sensory neuron specific)DepositorInsertvhhGFP4-ZIF-1 (zif-1 Nematode, Synthetic)
UseTargeting vector for mos1 transposon mediated sin…TagsvhhGFP4 (GFP nanobody)PromoterPosm-6Available SinceJune 27, 2017AvailabilityAcademic Institutions and Nonprofits only -
pJW1583
Plasmid#121054PurposeGFP^SEC^AID*::3xFLAG vector with ccdB sites for cloning homology arms.DepositorInsertGFP^SEC^AID*::3xFlag
UseCRISPR and Cre/LoxTags3xFLAG, C. elegans codon optimized GFP, and auxin…ExpressionWormAvailable SinceJune 7, 2019AvailabilityAcademic Institutions and Nonprofits only -
-
p426_Cas9_gRNA-R-RDS1a
Plasmid#87405Purposep426_Cas9_gRNA-RDS1a without the ribozyme All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting RDS1a sequence ATTCAATACGAAATGTGTGC in yeast chromosome 3.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting RDS1a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
MAC-CTSB
Plasmid#172413PurposeMAC-tagged gene expressionDepositorAvailable SinceNov. 4, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits -
pJW1584
Plasmid#121055PurposeYPET^SEC^AID*::3xFLAG vector with ccdB sites for cloning homology arms.DepositorInsertYPET^SEC^AID*::3xFlag
UseCRISPR and Cre/LoxTags3xFLAG, C. elegans codon optimized YPET, and auxi…ExpressionWormAvailable SinceJune 7, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-VTKD4-ChR2-YFP
Plasmid#178721PurposeAAV vector for Cre- and Flp-dependent transgene expression (CRE-ON / FLP-ON) of ChR2-YFP in cortical interneurons under the control of the Dlx enhancer (Dimidschstein et al 2016)DepositorInsertChR2-YFP
UseAAVAvailable SinceMay 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
LMPd Ametrine Got2 shRNA#3
Plasmid#220593PurposeRetroviral vector with Ametrine marker for expression shRNA with an "UltramiR" microRNA scaffoldDepositorInsertGot2 shRNA (Got2 Mouse)
UseRetroviralAvailable SinceJune 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
pKLV-EF1a-BFPCDK6-W
Plasmid#208756PurposeLentiviral vector expressing BFP fused with CDK6 cDNADepositorInsertCDK6 (CDK6 Human)
UseLentiviralAvailable SinceJan. 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-VTKS5-ChR2-YFP
Plasmid#178725PurposeAAV vector for Cre- and Flp-dependent transgene expression (CRE-ON / FLP-OFF) of ChR2-YFP in neurons under the control of the hSyn1 promoter (Kugler et al 2003)DepositorInsertChR2-YFP
UseAAVAvailable SinceMay 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-R-ARS607c
Plasmid#87409Purposep426_Cas9_gRNA-ARS607c without ribozyme All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS607c sequence CTATTTTTGCTTTCTGCACA in yeast chromosome 6.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS607c
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
MAC-CLEC4D
Plasmid#172411PurposeMAC-tagged gene expressionDepositorInsertC-type lectin domain family 4 member D (CD antigen CD368) (CLEC4D Human)
TagsMAC-tagExpressionMammalianPromoterCMV promoterAvailable SinceNov. 4, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits -
pACE-MBP-FBXL17 (310–701)
Plasmid#228369Purposeexpress human FBXL17 in insect cells, such as Trichoplusia ni Hi5DepositorAvailable SinceMay 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV hSyn INTRON HaloTag-STIM1 WPRE
Plasmid#236233PurposeAAV expression of mouse STIM1 internally tagged with HaloTagDepositorAvailable SinceMay 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
LMPd Ametrine Got1 shRNA#1
Plasmid#220592PurposeRetroviral vector with Ametrine marker for expression shRNA with an "UltramiR" microRNA scaffoldDepositorInsertGot1 shRNA (Got1 Mouse)
UseRetroviralAvailable SinceAug. 13, 2024AvailabilityAcademic Institutions and Nonprofits only