We narrowed to 9,378 results for: mel
-
Plasmid#227163PurposeFor T-REX experiments of CYP2A6 C82A and C439A double mutant. Almost no sensing ability to reactive electrophilic species (RES).DepositorInsertCYP2A6 (CYP2A6 Human)
TagsFlag, HaloTag, and His6ExpressionMammalianMutationchanged cysteine 82 and cysteine 439 to alaninePromoterCMV and SP6Available SinceAug. 19, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMT-sfGFP-TurboID-ER
Plasmid#240230PurposeExpression of ER-localized sfGFP-TurboID under control of copper-inducible promoter. Can be used to generate stable cell lines by Hygromycin selection.DepositorInsertBIP-sfGFP-TurboID-KDEL
ExpressionInsectPromoterMTAvailable SinceJuly 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMT-Myc-BirA*G3-ER
Plasmid#240234PurposeExpression of ER-localized Myc-BirA*-G3 under control of copper-inducible promoter. Can be used to generate stable cell lines by Hygromycin selection.DepositorInsertBiP-Myc-BirA*G3-KDEL
ExpressionInsectPromoterMTAvailable SinceJuly 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
AAV-DIO- alpha-MSH
Plasmid#239044PurposeOverexpression of alpha-MSHDepositorAvailable SinceMay 21, 2025AvailabilityAcademic Institutions and Nonprofits only -
AAV-DIO-beta-Endorphin
Plasmid#239043PurposeOverexpression of beta endorphinDepositorAvailable SinceMay 21, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPR-v1-sgABCC4_1
Plasmid#217433PurposeLentiviral vector expressing Cas9 and an sgRNA targeting human ABCC4DepositorInsertsgRNA 1 targeting ABCC4 (ABCC4 Human)
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceJan. 31, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPR-v1-sgABCC4_3
Plasmid#217434PurposeLentiviral vector expressing Cas9 and an sgRNA targeting human ABCC4DepositorInsertsgRNA 3 targeting ABCC4 (ABCC4 Human)
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceJan. 31, 2025AvailabilityAcademic Institutions and Nonprofits only -
ENTR_BN001T-N_START
Plasmid#218058PurposeRESOLUTE SLC binder cloning plasmidDepositorInsertBN001T-N_START
UseCloning plasmidAvailable SinceMay 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
ENTR_BN006A-P_START
Plasmid#218059PurposeRESOLUTE SLC binder cloning plasmidDepositorInsertBN006A-P_START
UseCloning plasmidAvailable SinceMay 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
ENTR_BN001M-T_START
Plasmid#218060PurposeRESOLUTE SLC binder cloning plasmidDepositorInsertBN001M-T_START
UseCloning plasmidAvailable SinceMay 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
EF1a-SRRD-V5-APEX2 (in pLEX_307)
Plasmid#214921Purposeconstitutive expression of SRRD fused to V5 and APEX2 - used for APEX2 proximity biotinylationDepositorAvailable SinceMarch 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
pUb FLAG-Zebrafish IntS6
Plasmid#198410PurposeExpresses FLAG-tagged zebrafish IntS6DepositorAvailable SinceNov. 29, 2023AvailabilityAcademic Institutions and Nonprofits only -
pUb FLAG-Zebrafish IntS6L
Plasmid#198411PurposeExpresses FLAG-tagged zebrafish IntS6LDepositorAvailable SinceNov. 29, 2023AvailabilityAcademic Institutions and Nonprofits only -
p Pcrg1: Khd4-Ada-Gfp (CbxR)
Plasmid#203734PurposePlasmid for ectopic integration and expression of Khd4-Ada-Gfp. The 4282 bp khd4-ORF is fused C-terminally to the 1200 bp adar catalytic domain (Ada) with three repeats of GGGGS linker in between, folDepositorInsertKhd4-Ada-Gfp
TagsGfpExpressionBacterialPromoterPcrg1Available SinceAug. 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
pX459-dTLN1 exon
Plasmid#176033PurposeA vector for the CRISPR-Cas9 system targeting an exon of dog TLN1 (talin1)DepositorInsertA gRNA targeting the dog TLN1 gene and the cDNA of Cas9 (TLN1 )
UseCRISPRExpressionMammalianAvailable SinceOct. 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX459-dTLN1 intron
Plasmid#176224PurposeA vector for the CRISPR-Cas9 system targeting an intron of dog TLN1 (talin1)DepositorInsertA gRNA targeting the dog TLN1 gene and the cDNA of Cas9 (TLN1 )
UseCRISPRExpressionMammalianAvailable SinceOct. 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
pET-Duet1-6xHis-TEV-NDP52
Plasmid#190194PurposePlasmid for the protein expression of 6xHis-TEV-NDP52 in a bacterial expression system. Internal reference: SMC401DepositorAvailable SinceOct. 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAP14
Plasmid#186262PurposewgaA (a.k.a expA1) and wgaB (a.k.a expA23), bicistronic, under light light responsive PEL222 promoter and EL222 under constitutively active LacIq promoterDepositorInsertsExpressionBacterialPromoterLacIq (CGAATGGTGCAAAACCTTTCGCGGTATGGCATGATAGCGCCC…Available SinceAug. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCS2z-lmo2
Plasmid#164657Purposefor the synthesis of zebrafish lmo2 mRNADepositorAvailable SinceJuly 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
pESC-LEU-IpgD
Plasmid#183672PurposeInducible Shigella flexneri IpgD for expression in yeastDepositorInsertIpgD
ExpressionYeastPromoterGAL1Available SinceMay 3, 2022AvailabilityAcademic Institutions and Nonprofits only