We narrowed to 10,686 results for: ADA
-
Plasmid#146392PurposeInsect Expression of DmeIF4G-trunc. *Note: this plasmid does not contain an HA-tag as the name implies.DepositorInsertDmeIF4G-trunc (eIF4G1 Fly)
ExpressionInsectMutation322-1666 truncated version of elF4G sequence with…Available SinceMarch 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCMV_NOPLight-ctr
Plasmid#195579PurposeExpresses the control sensor NOPLight-ctr in mammalian cellsDepositorInsertNOPLight-ctr
ExpressionMammalianMutationD110A, D130APromoterCMVAvailable SinceAug. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
pBullet-end-c
Plasmid#53074Purposedestination vector with ECFP- endosome marker (RabF2a) for tagged fluorescent protein (C-ter-EYFP) of plant geneDepositorTypeEmpty backboneUseSynthetic BiologyAvailable SinceJan. 28, 2015AvailabilityAcademic Institutions and Nonprofits only -
pKK-NoTag
Plasmid#105767PurposeControl vector for pKK series (encodes only SLIC arms (TEV-L and TEV-R)); expression without tag. Useful to design other vectors; any tag can be added.DepositorTypeEmpty backboneUseFlp-in competentExpressionMammalianAvailable SinceFeb. 9, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAVA-Gal11p-LGF2(fs)
Plasmid#127482PurposeNegative control for the AVA-seq system. Gal11p (lambda CI associated) and LGF2 (with one nucleotide insertion) (RNAp associated) interactionDepositorInsertGal11p-LGF2(frame shifted) (GAL11 Budding Yeast)
ExpressionBacterialMutationLGF2 is frame shifted by the insert of one nucleo…Available SinceNov. 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
GFP-APPL1-R146A/K152A/R154A
Plasmid#59767PurposeExpresses APPL1 Endosomal Localization MutantDepositorAvailable SinceSept. 29, 2014AvailabilityAcademic Institutions and Nonprofits only -
pAAV_hSynapsin1_NOPLight1
Plasmid#195580PurposeExpresses NOPLight1 in neuronsDepositorInsertNOPLight1
UseAAVExpressionMammalianPromoterhuman Synapsin-1Available SinceAug. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
qTAG-C-moxGFP-Puro-H3C2
Plasmid#207783PurposeDonor template for moxGFP-2A-Puro insertion into the C-terminus of the H3C2 locus for nuclei visualization. To be co-transfected with sgRNA plasmid px330-PITCh-H3C2 Addgene #207780DepositorInsertH3C2 Homology Arms flanking a moxGFP-Puro Cassette (H3C2 Human)
UseCRISPR; Donor templateExpressionMammalianAvailable SinceNov. 29, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
pAAV-hSyn-DIO-GRAB_CCK1.0
Plasmid#208674PurposeExpresses the genetically-encoded fluorescent cholecystokinin (CCK) sensor GRAB_CCK1.0 in a cre-dependent mannerDepositorInsertGPCR activation based cholecystokinin (CCK) sensor GRAB_CCK1.0
UseAAVPromoterhSynAvailable SinceOct. 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
pDN-G1TGt
Plasmid#44508DepositorInsertsUseSynthetic Biology; Expression regulator/reporterExpressionYeastMutationTwo tandem tet operators (2XtetO2) downstream of …PromoterPGal1-D12 promoterAvailable SinceApril 23, 2013AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-GRAB_NPYmut
Plasmid#208679PurposeExpresses the genetically-encoded fluorescent neuropeptide Y (NPY) control sensor GRAB_NPYmut in neuronsDepositorInsertGPCR activation based neuropeptide Y (NPY) control sensor GRAB_NPYmut
UseAAVPromoterhSynAvailable SinceOct. 13, 2023AvailabilityAcademic Institutions and Nonprofits only -
pHAGE2-TetOminiCMV-Klf4
Plasmid#136613PurposeDox-inducible lentiviral vector expressing mouse Klf4DepositorAvailable SinceMarch 25, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCold I-Hero13
Plasmid#187929PurposeBacterial expression of heat-resistant obscure (Hero) protein Hero13DepositorAvailable SinceOct. 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5-FRT-T0-Flag-HROB
Plasmid#135298PurposeExpresses Flag-tagged HROB in mammalian cellsDepositorAvailable SinceMarch 2, 2020AvailabilityIndustry, Academic Institutions, and Nonprofits -
pLKO.1-shGBP1.1.mKO2
Plasmid#85209PurposeTRCN0000116119 (Target CGACGAAAGGCATGTACCATA) for silencing GBP1 gene and express monomeric Kusabira-Orange2.DepositorInsertGBP1 (guanylate binding protein 1) (GBP1 Human)
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceOct. 4, 2017AvailabilityAcademic Institutions and Nonprofits only -
ApoE3_mCh-SspB (pBS1144)
Plasmid#185326PurposeFor the mammalian expression of the human protein ApoE3 attached to SspB for light inducible binding to iLID scaffolds. Systems like this can be used to induce condensate formationDepositorInsertApoE3
ExpressionMammalianAvailable SinceJune 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
AAV2_hSyn_Phobos_Citrine
Plasmid#98216PurposeBlue-shifted artificial anion conducting channelrhodopsin (aACR). Activation max 466 nm; off-kinetics 10 ms. Codon optimized for mammalian expression.DepositorInsertSynthetic construct Phobos gene
UseAAVTagsCitrineExpressionMammalianMutationT59S, E83N, E90Q, E101S, V117R, E123S, T159G, G16…Promoterhuman synapsinAvailable SinceAug. 22, 2017AvailabilityAcademic Institutions and Nonprofits only -
pKK-FLAG-TEV
Plasmid#105768PurposeExpression of your protein of interest in fusion with FLAG at the N-terminus. The tag is cleavable by TEV protease or enterokinase.DepositorTypeEmpty backboneUseFlp-in competentTagsFLAG-TEVExpressionMammalianAvailable SinceApril 6, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLX307 DEDD
Plasmid#117744PurposeOpen reading frame vector encoding DEDDDepositorAvailable SinceFeb. 21, 2019AvailabilityAcademic Institutions and Nonprofits only -
pGEX 4t1 RARalpha (1-187)
Plasmid#35558DepositorAvailable SinceApril 5, 2012AvailabilityAcademic Institutions and Nonprofits only