We narrowed to 134,541 results for: MYC;
-
Plasmid#119053Purpose3rd gen transfer vector. HLA-B2705 linked to b2-microglobulin and CD28-CD3z signaling domain. Contains the HIV(gag) KK10 epitope "KRWIILGLNK" cloned via BsmBIDepositorInsertB2705-KK10-SABR
UseLentiviralExpressionMammalianPromoterMNDAvailable SinceJan. 28, 2019AvailabilityAcademic Institutions and Nonprofits only -
Dom neg CstF64
Plasmid#127250PurposeExpresses the Dominant Negative CstF64 in mammalian cells; DN blocks polyadenylationDepositorInsertCstF64 delta 282 (CSTF2 Human)
UseOtherExpressionMammalianMutationinsert @SanD1:GTCCAGGCGCCTACCCATACGACGTCCCAGACTAC…PromoterpEF1aAvailable SinceJuly 15, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-syn-FLEX-synaptoPAC-minWPRE
Plasmid#153100PurposeCre-conditional expression of synaptoPAC, a fusion of synaptophysin, mScarlet, and bPAC in neuronsDepositorInsertsUseAAVTagsHis tag, mScarlet, and myc tagExpressionMammalianAvailable SinceAug. 26, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV.hSyn.FLEX.SYFP2-POST-T2A-dTomato.FLEX.WPRE.SV40
Plasmid#105983PurposeThis AAV plasmid in the presence of Cre recombinase expresses an extracellular SYFP2 fused to the neuroligin-1 cytoplasmic domain for targeting to the synapse with a cell fill dTomato.DepositorInsertFLEX-SYFP2-POST-T2A-dTomato.FLEX
UseAAV and Cre/LoxTagsSYFP2-POST, T2A-dTomato, and mycExpressionMammalianPromoterhuman Synapsin 1Available SinceOct. 9, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCAD104_Asn152Ser_pCMV6Entry-hIRG1
Plasmid#124877PurposeExpresses hCAD Asp152Ser mutant in mammalian cellsDepositorInsertcis-aconitate decarboxylase (ACOD1 Human)
Tagsmyc and FLAG tagsExpressionMammalianMutationmutated Asn152 to SerPromoterCMVAvailable SinceSept. 16, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCAD64_pCMV6_Entry_hIrg1
Plasmid#124879PurposeExpresses hCAD His103Ala mutant in mammalian cellsDepositorInsertcis-aconitate decarboxylase (ACOD1 Human)
Tagsmyc and FLAG tagsExpressionMammalianMutationmutated His103 to AlaPromoterCMVAvailable SinceSept. 16, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAG657 H2B-pFAST
Plasmid#172862PurposeExpresses pFAST fused to zebrafish histone H2B in mammalian cellsDepositorInsertH2B-pFAST
TagsMyc tag (C terminal on insert)ExpressionMammalianPromoterCMVAvailable SinceFeb. 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-eGFP-SynaptoZip
Plasmid#122525PurposeAAV expression of the synaptic activity-marker SynaptoZip fused to eGFP driven by human Synapsin promoterDepositorAvailable SinceMarch 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
JE301: pMVP (L5-L4) Tir1-P2A-AID
Plasmid#121722PurposepMVP L5-L4 entry plasmid, contains Tir1-P2A-AID for 4-component MultiSite Gateway Pro assembly. Allows expression of N-term Tir1 linked by P2A to AID domain fused to gene of interest.DepositorInsertosTir1-P2A-AID (open)
UseSynthetic Biology; Pmvp gateway entry plasmidTags9x myc (C-term on osTIR1)Available SinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
pHRIG-PRAS40
Plasmid#53599Purposelentiviral expression of constitutively active PRAS40 and EGFPDepositorInsertPRAS40 (AKT1S1 Human)
UseLentiviralTagsIRES-EGFP and mycExpressionMammalianMutationconstitutively active (myristoylated version)PromoterCMVAvailable SinceSept. 8, 2014AvailabilityAcademic Institutions and Nonprofits only -
pRV FOXP3 WWRR
Plasmid#13625DepositorInsertFOXP3 (FOXP3 Human)
UseRetroviralTagsMycExpressionMammalianMutationWWRR: T359W, N361W, E399R, E401RAvailable SinceDec. 15, 2006AvailabilityAcademic Institutions and Nonprofits only -
-
pAG665 MAP4-pFAST
Plasmid#172865PurposeExpresses MAP4-pFAST in mammalian cells (microtubule labeling)DepositorInsertMAP4-pFAST
TagsMyc tag (C terminal on insert)ExpressionMammalianPromoterCMVAvailable SinceFeb. 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLenti-hPGK-mCherry-SynaptoZip
Plasmid#177317PurposeLentiviral expression of the synaptic activity-marker SynaptoZip fused to mCherry driven by hPGK promoterDepositorAvailable SinceJune 24, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-DIO {mCAR}off-{ChETA}on-WPRE
Plasmid#111387PurposeAAV vector with hSynapsin promoter, Cre-OFF mCAR (for efficient CAV-2 infection) and Cre-ON ChETA (for optogenetic activation)DepositorAvailable SinceJune 8, 2018AvailabilityAcademic Institutions and Nonprofits only -
CMV-A3A-seBE4max-IRES
Plasmid#174698PurposeSmall-molecule controlled base editingDepositorInsertA3A-seBE4max-IRES (APOBEC3A Human)
Tagsmyc tagExpressionMammalianMutationA3A-M13I, UGI-E11KPromoterCMVAvailable SinceNov. 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
FR_HNF4A2-C106R
Plasmid#31123DepositorInsertHNF4A (HNF4A Human)
TagsMycExpressionMammalianMutationsplice variant 2, mutation C106R. Wild type seq…Available SinceOct. 14, 2011AvailabilityAcademic Institutions and Nonprofits only -
(367) pcDNA3.1-HA-nUbc-(EAAAK)4-OGA(544-706)
Plasmid#168099PurposeHA- tagged Ubc6E nanobody fused to human OGA stalk domain residues (544-706). Used in combination with myc-OGA(1-400) to create split-OGADepositorInsertHA-nUbc-OGA(544-706)
TagsHA-tagExpressionMammalianMutationOGA truncated to contain residues 544-706PromoterT7/CMVAvailable SinceJune 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV.hSyn.FLEX.FAPdL5-POST-T2A-dTomato.FLEX.WPRE.SV40
Plasmid#105982PurposeThis AAV plasmid in the presence of Cre recombinase expresses an extracellular dL5 FAP fused to the neuroligin-1 cytoplasmic domain for targeting to the synapse with a cell fill dTomato.DepositorInsertFLEX-FAPdL5-POST-T2A-dTomato.FLEX
UseAAV and Cre/LoxTagsFAPdL5-POST, T2A-dTomato, and mycExpressionMammalianPromoterhuman synapsin 1Available SinceOct. 9, 2019AvailabilityAcademic Institutions and Nonprofits only -
pPICZ-aC-KHC-BZ
Plasmid#160427PurposeExpression of c-luciferase from sp. Kornikeria hastingsi carriebowae (Belize)DepositorInsertluciferase
UseLuciferaseTags6x Histidine tag, Yeast alpha secretion factor, c…ExpressionYeastPromoterAOXAvailable SinceOct. 23, 2020AvailabilityAcademic Institutions and Nonprofits only