We narrowed to 25,285 results for: crispr
-
Plasmid#85571PurposeExpresses sgRNA targeting human AAVS1 locusDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertadeno-associated virus integration site 1 (AAVS1 Human)
ExpressionMammalianAvailable sinceFeb. 8, 2017AvailabilityAcademic Institutions and Nonprofits only -
pJEP13-AAV-H1/TO-L-sgRNA(Tet2)-CMV-TetR-P2A-eGFP-KASH-pA
Plasmid#82703PurposeAAV backbone with a full length H1/TO promoter driving expression of a sgRNA that targets exon 3 of the mouse Tet2 locus. TracrRNA compatible with SpCas9. gRNA transcription is doxycycline dependent.DepositorInsertH1/TO-L gRNA Expression Cassette Containing Tet2 gRNA
UseAAV and CRISPRTagsCMV promoter driving expression of TetR-P2A-GFP-K…ExpressionMammalianAvailable sinceDec. 20, 2016AvailabilityAcademic Institutions and Nonprofits only -
LIR_TRE_CAG_mKateII-Puro-STOP_mVenus-Cas9-PA-RIR
Plasmid#68345PurposeA Sleeping beauty transposon with conditional expressed hCas9. A red flourescent gene linked to puromycin can be removed in the prescence of Flp recombinase allowing Cas9 expressionDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertspuromycin
hCas9
UseCRISPR; Flp/frtTagslinked to red flouresent protein gene mKateII and…ExpressionMammalianPromoterCAGAvailable sinceOct. 5, 2015AvailabilityAcademic Institutions and Nonprofits only -
pQCi
Plasmid#154345PurposeSelf-Cutting and Integrating CRISPR backbone (px458 derivative with Cas9-intron, sgRNA, and bait integration sites)DepositorTypeEmpty backboneUseCRISPRExpressionMammalianAvailable sinceJuly 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
pHEE-R-kan5A9si
Plasmid#222836PurposeCRISPR/Cas9 for multi-gene knockout in Arabidopsis (single intron-containing Cas9, RPS5A promoter, kanamycin and red fluorescent seed selection)DepositorTypeEmpty backboneUseCRISPRAvailable sinceOct. 3, 2024AvailabilityAcademic Institutions and Nonprofits only -
pHEE-R-bar5A9si
Plasmid#222837PurposeCRISPR/Cas9 for multi-gene knockout in Arabidopsis (single intron-containing Cas9, RPS5A promoter, bialaphos and red fluorescent seed selection)DepositorTypeEmpty backboneUseCRISPRAvailable sinceOct. 3, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCBh_3x Flag-NLS-denOsCas12f1-NLS-VPR-NLS-mCherry_pA_phU6_gRNA scaffold-spacer_pCMV_BFP_pA
Plasmid#197031PurposeVector encoding a human codon-optimized dead enOsCas12f1 (denOsCas12f1)-VPR driven by CBh promoter, guide RNAs compatible with enOsCas12f1 driven by hU6, and BFP driven by CMV promoterDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInserthumanized denOsCas12f1-VPR
ExpressionMammalianMutationD52R / T132R / D228A / D406APromoterCBh, CMV, hU6Available sinceMay 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCMV-T7-SpCas9-NG-P2A-mScarlet (MNW005)
Plasmid#174140PurposeCMV and T7 promoter expression plasmid for human codon optimized SpCas9-NG(L1111R/D1135V/G1218R/E1219F/A1322R/R1335V/T1337R) with a c-terminal bi-partite NLS, 3x flag tag, and P2A-mScarletDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInserthuman codon optimized SpCas9-NG with BPNLS-3xFLAG-P2A-mScarlet
UseIn vitro transcription; t7 promoterTagsBPNLS-3xFLAG-P2A-mScarletExpressionMammalianMutationSpCas9-NG=L1111R/D1135V/G1218R/E1219F/A1322R/R133…PromoterCMV and T7Available sinceSept. 7, 2021AvailabilityAcademic Institutions and Nonprofits only -
pRS118
Plasmid#234878PurposeCRISPR-Cas9 plasmid for use in Candida albicans. Contains Cas9, NEUT5L integration site, and the sgRNA cloning site (SNR52 promoter)DepositorTypeEmpty backboneUseCRISPR and Synthetic BiologyExpressionYeastAvailable sinceJan. 7, 2026AvailabilityAcademic Institutions and Nonprofits only -
pV1464
Plasmid#111440PurposeN. castellii Solo CRISPR vector, marked with URA3 and NatRDepositorInsertCaCas9/sgRNA-BsmBI stuffer
UseCRISPRExpressionYeastAvailable sinceAug. 29, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCXLE-dCas9VPP300-T2A-GFP-shP53
Plasmid#102896PurposeEBNA episome plasmid for CAG promoter constitutive expression of dCas9-VP192-P300core followed by T2A-GFP as a reporter. Includes p53 shRNA expression cassette.DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertdCas9VPP300-T2A-GFP-shP53
UseCRISPRExpressionMammalianMutationD10A, H840APromoterCAGAvailable sinceJuly 10, 2018AvailabilityAcademic Institutions and Nonprofits only -
pROS12
Plasmid#107926Purposehph based Yeast/E.coli shuttle vector designed to clone and express Cas9 programming spacerDepositorInsertgRNA-CAN1.Y, gRNA-ADE2.Y
UseCRISPRExpressionYeastAvailable sinceApril 18, 2018AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pMEL13
Plasmid#107919Purposekan based Yeast/E.coli shuttle vector designed to clone and express Cas9 programming spacerDepositorInsertgRNA-CAN1.Y
UseCRISPRExpressionYeastAvailable sinceApril 18, 2018AvailabilityAcademic Institutions and Nonprofits onlyCited by -
sgTP53(R273)
Plasmid#85561PurposeExpresses sgRNA targeting human TP53 around codon R273DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInserttumor protein p53 (TP53 Human)
ExpressionMammalianAvailable sinceFeb. 8, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLCKO_PSMD1_sgRNA_1
Plasmid#74180Purposelentiviral vector expressing sgRNA targeting PSMD1DepositorInsertPSMD1 sgRNA
UseCRISPR and LentiviralExpressionMammalianPromoterU6 PromoterAvailable sinceMarch 30, 2016AvailabilityAcademic Institutions and Nonprofits onlyCited by -
GFP-itis pBE-t
Plasmid#195342PurposeBase editor plasmid expressing ABE8e-NG-Cas9n under Theophylline Riboswitch and constituitively expressed gRNA targeting EGFP A110VDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertsecTadA(8e)-SpCas9-NG
gRNA ctctacgcgggtcttgtagt
UseCRISPRMutationSpCas9n-NG: D10A, L1111R, D1135V, G1218R, E1219F,…PromoterLac and ProCAvailable sinceJan. 31, 2023AvailabilityAcademic Institutions and Nonprofits only -
pET28-His-MBP-NLS-RfxCas13d-NLS-HA
Plasmid#171586PurposeBacterial expression of NLS-RfxCas13d-NLS-HADepositorInsertHis-MBP-NLS-RfxCas13d-NLS-HA
TagsHAExpressionBacterialAvailable sinceOct. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
LbdCas12a VPR
Plasmid#188513PurposeExpresses FLAG tagged LbdCas12a VPRDepositorInsertdCas12a
UseCRISPR and LentiviralExpressionMammalianMutationD832APromoterEF1aAvailable sinceSept. 29, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAcHELIX-sgRNA_entry (CJT94)
Plasmid#181783PurposeExpresses AcHELIX containing a nicking I-AniI fusion to AcTnsB. New sgRNA spacer sequences can be added using Golden Gate assembly (via SapI sites).DepositorInsertnAniI-AcTnsB, AcTnsC, AcTniQ, AcCas12k
ExpressionBacterialMutationnAniI = K227M, F80K, L232KPromoterLac and J23119Available sinceMarch 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
pShHELIX(Cas12k-TniQ-TniQ)-sgRNA_entry (CJT112)
Plasmid#181791PurposeExpresses 3-component ShHELIX containing a Cas12k-TniQ-TniQ fusion. New sgRNA spacer sequences can be added using Golden Gate assembly (via SapI sites).DepositorInsertnAniI-ShTnsB, ShTnsC, ShCas12k-ShTniQ-ShTniQ
ExpressionBacterialMutationnAniI = K227M, F80K, L232KPromoterLac and J23119Available sinceFeb. 18, 2022AvailabilityAcademic Institutions and Nonprofits only