We narrowed to 1,236 results for: POLI
-
Plasmid#175277PurposeAAV vector mediating inducible expression of 4 genes (the C-prM-E-NS1) of YFV-17DDepositorAvailable SinceDec. 8, 2021AvailabilityAcademic Institutions and Nonprofits only
-
pEGFP-C1-AR Q48
Plasmid#86428PurposeFluorescent human androgen receptor (fused to EGFP) with expanded polyglutamine regionDepositorInsertAndrogen receptor (AR) (AR Human)
TagsEGFPExpressionMammalianMutationPoly-glutamine expansion, G130DPromoterCMVAvailable SinceApril 28, 2017AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-C1-AR Q0
Plasmid#86427PurposeFluorescent human androgen receptor (fused to EGFP) with deleted polyglutamine regionDepositorInsertandrogen receptor (AR) (AR Human)
TagsEGFPExpressionMammalianMutationDeletion of the poly-glutamine expansionPromoterCMVAvailable SinceApril 28, 2017AvailabilityAcademic Institutions and Nonprofits only -
FUW-C-prM-E-NS1
Plasmid#175281Purposelentiviral vector mediating bicistronic expression of the 4 genes of YFV-17D (C-prM-E-NS1) and EGFP.DepositorInsertC-prM-E-NS1 and EGFP (POLY Yellow fever virus strain 17D)
UseLentiviralTagsIRES EGFPPromoterhuman ubiquitin CAvailable SinceDec. 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-SCP1-dSa VPR mini.-2X snRP-1 Actc1
Plasmid#99690PurposeExpresses dSa Cas9 fused to optimized combination of truncated activation domains from SCP1 promoter with dual snRP1 poly adenylation signal, and Sa sgRNA for Actc1, vector allows for strong activation of mouse Actc1, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Actc1 (gRNA sequence: GCCATTCTTGGAGCCAAGGG ) (Actc1 Synthetic, Mouse)
UseAAV and CRISPRTagsVPR miniMutationdead Cas9Available SinceSept. 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
AAV-Syn-NS1
Plasmid#175276PurposeAAV vector mediating bicistronic expression of NS1 gene of YFV-17D and dTomato with NLSDepositorInsertNonstructural protein 1 (NS1) of YFV-17D; NLS-dTomato (POLY Yellow fever virus strain 17D)
UseAAVTagsNLS-dTomato (P2A cleavage)PromoterSynapsinAvailable SinceNov. 30, 2021AvailabilityAcademic Institutions and Nonprofits only -
pET28_6xHis-PARP1delZn2delBRCT
Plasmid#173939PurposeBacterial expression of PARP1 lacking Zn2 and BRCT domainsDepositorInsertPARP1delZn2delBRCT (PARP1 Human)
Tags6xHisExpressionBacterialMutationDeletion of residues 97-213 and 374-520; V762AAvailable SinceSept. 30, 2021AvailabilityAcademic Institutions and Nonprofits only -
pET28_6xHis-PARP1-E988K
Plasmid#173945PurposeBacterial expression of inactive PARP1 mutant (E988K attenuates catalytic and PAR-branching activity of PARP1)DepositorAvailable SinceSept. 30, 2021AvailabilityAcademic Institutions and Nonprofits only -
AAV-TRE-NS1-dTomato
Plasmid#175278PurposeAAV vector mediating inducible bicistronic expression of NS1 gene of YFV-17D and dTomatoDepositorInsertNS1; dTomato (POLY Yellow fever virus strain 17D)
UseAAVTagsdTomato (from bidirectional promoter)Promoterbidirectional TRE promoterAvailable SinceDec. 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-DIO-NS1
Plasmid#175273PurposeAAV vector mediating Cre-depenent expression of NS1 gene of YFV-17DDepositorInsertNonstructural protein 1 (NS1) of YFV-17D (POLY Yellow fever virus strain 17D)
UseAAVPromoterSynapsinAvailable SinceNov. 30, 2021AvailabilityAcademic Institutions and Nonprofits only -
pET28_6xHis-PARP1-CATdeltaHD
Plasmid#174811PurposeBacterial expression of a hyperactive PARP1 CAT lacking the autoinhibitory HD subdomainDepositorInsertPARP1-CATdeltaHD (PARP1 Human)
Tags6xHisExpressionBacterialMutationResidues 678-787 replaced by eight-residue linker…Available SinceSept. 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-SCP1-dSa VPR mini.-2X snRP-1 Neurog2
Plasmid#99694PurposeExpresses dSa Cas9 fused to optimized combination of truncated activation domains from SCP1 promoter with dual snRP1 poly adenylation signal, and Sa sgRNA for Actc1, vector allows for strong activation of mouse Actc1, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Actc1 (gRNA: GGTATATAAGGGGTTTTAAG) (Actc1 Synthetic, Mouse)
UseAAV and CRISPRTagsVPR miniMutationdead Cas9Available SinceJan. 16, 2020AvailabilityAcademic Institutions and Nonprofits only -
pET28_6xHis-PARP1-CAT-L713F
Plasmid#173944PurposeBacterial expression of isolated PARP1 CAT domain containing L713F gain-of-function mutationDepositorAvailable SinceSept. 30, 2021AvailabilityAcademic Institutions and Nonprofits only -
pET28_6xHis-PARP1-L713F
Plasmid#174794PurposeBacterial expression of a hyperactive PARP1 mutant (L713F destabilizes the autoinhibitory HD subdomain)DepositorAvailable SinceSept. 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
pET28_6xHis-PARP1-C125G
Plasmid#174792PurposeBacterial expression of a less active PARP1 mutant (C125G reduces affinity for single-strand DNA break)DepositorAvailable SinceSept. 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
pET28_6xHis-PARP1-Y986H
Plasmid#174801PurposeBacterial expression of a PARP1 mutant that produces highly branched but short PAR chains overallDepositorAvailable SinceSept. 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
pET28_6xHis-PARP1-Y986S
Plasmid#174802PurposeBacterial expression of a PARP1 mutant that produces mainly short PAR oligomersDepositorAvailable SinceSept. 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
pET28_6xHis-PARP1-G972R
Plasmid#174800PurposeBacterial expression of a PARP1 mutant that produces less PAR oligomers overallDepositorAvailable SinceSept. 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
pET28_6xHis-PARP1delWGR-L713F
Plasmid#173941PurposeBacterial expression of PARP1 lacking WGR domain but containing L713F gain-of-function mutationDepositorInsertPARP1delWGR-L713F (PARP1 Human)
Tags6xHisExpressionBacterialMutationDeletion of residues 521-660; L713F, V762AAvailable SinceSept. 30, 2021AvailabilityAcademic Institutions and Nonprofits only -
pET28_6xHis-PARP1-A774L
Plasmid#174796PurposeBacterial expression of a hyperactive PARP1 mutant (A774L destabilizes the autoinhibitory HD subdomain)DepositorAvailable SinceSept. 23, 2021AvailabilityAcademic Institutions and Nonprofits only