We narrowed to 8,872 results for: epor
-
Plasmid#80484PurposepiggyBac transposon for dox-inducible expression of the MKOS polycistronic reprogramming cassette (with mCherry)DepositorUsePiggybac transposonExpressionMammalianPromotertetOAvailable SinceNov. 28, 2016AvailabilityAcademic Institutions and Nonprofits only
-
MB 93C1 thsS(t3)R-Bxb1_P7-bARGSer
Plasmid#232469PurposeOptimized thiosulfate sensor with recombinase switch and acoustic reporter genes (bARGSer)DepositorInsertsthsS(t3)
thsR
PphsA342
bARGSer
AxeTxe
Bxb1 integrase
TagsssrA degradation tagExpressionBacterialMutationContains the following mutations K286Q, Q350H, I…PromoterJ23104 (ttgacagctagctcagtcctaggtattgtgctagc), J23…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHAGE2-TetO-OCT4-KLF4-cMYC
Plasmid#216175PurposeGenerate lentiviruses encoding for OCT4, KLF4 and c-MYC (polycistronic vector); used in conjunction with SOX vectors for pluripotency reprogrammingDepositorAvailable SinceJuly 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
AIMTOR T757
Plasmid#140828PurposeAIMTOR T757 contains a cytoplasmic mTOR Activity Reporter derived from hu ULK1 protein boxed between BRET-compatible entities (Ypet and Nanoluciferase) to measure mTOR activity in living cellsDepositorInsertAIMTOR T757 (ULK1 Human)
TagsNES Nuclear export signalExpressionMammalianMutationThe insert comprises only a small sequence of hum…Available SinceJuly 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
PB-TAC-OKMS
Plasmid#80480PurposepiggyBac transposon for dox-inducible expression of the OKMS (Oct4, Klf4[10-483], c-Myc, Sox2) polycistronic reprogramming cassette (with mCherry)DepositorUsePiggybac transposonExpressionMammalianMutationKlf4 [10-483]PromotertetOAvailable SinceNov. 28, 2016AvailabilityAcademic Institutions and Nonprofits only -
PB-TAC-OK+9MS
Plasmid#80482PurposepiggyBac transposon for dox-inducible expression of the OK+9MS (Oct4, Klf4[1-483], c-Myc, Sox2) polycistronic reprogramming cassette (with mCherry)DepositorUsePiggybac transposonExpressionMammalianMutationKlf4 [1-483]PromotertetOAvailable SinceNov. 28, 2016AvailabilityAcademic Institutions and Nonprofits only -
PB-TAC-EB-C5
Plasmid#80485PurposepiggyBac transposon for dox-inducible expression of the EB-C5 polycistronic reprogramming cassette (with mCherry)DepositorUsePiggybac transposonExpressionMammalianPromotertetOAvailable SinceNov. 28, 2016AvailabilityAcademic Institutions and Nonprofits only -
pPB-C6F/TdTomato
Plasmid#140826PurposeOCT4, SOX2, KLF4, C-MYC, KLF2, NANOG (C6F) and tdTomato under the control of TRE (Tet-ON)DepositorInsertsExpressionMammalianMutationL104P- please see depositor commentsAvailable SinceSept. 25, 2020AvailabilityAcademic Institutions and Nonprofits only -
PRESTO-Tango Kit
Plasmid Kit#1000000068PurposeReporters to measure receptor activation for G protein-coupled receptors (GPCRs) via a modified Tango beta-arrestin recruitment assay.DepositorApplicationGene Expression and LabelingVector TypeMammalian ExpressionAvailable SinceJan. 6, 2016AvailabilityAcademic Institutions and Nonprofits only -