We narrowed to 7,866 results for: ski
-
Plasmid#216857PurposeCIRTS RNA targeting system for targeted knockdown of m6A-containing transcript at the synapse. CIRTS-YTHDF2-Calm3 and scramble gRNA is expressed under human Syn1 and U6 promoter, respectively.DepositorInsertCIRTS-YTHDF2-Calm3-U6-control gRNA
UseLentiviralTagsGFPExpressionMammalianPromoterSyn1, U6Available SinceOct. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDONR223_AKR1B1_WT_V5
Plasmid#82953PurposeGateway Donor vector containing AKR1B1, used as an over expression control for gene expression analysis. Part of the Target Accelerator Plasmid Collection.DepositorAvailable SinceApril 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCIBN-hTRF1-tagRFP-T
Plasmid#103811PurposeBLInCR 'Localizer' construct that marks telomeres and is targeted by a PHR-tagged effector upon illumination with blue light; can be visualized without triggering PHR recruitmentDepositorAvailable SinceJan. 9, 2018AvailabilityAcademic Institutions and Nonprofits only -
pDONR223_RBM15B_WT_V5
Plasmid#83010PurposeGateway Donor vector containing RBM15B, used as an over expression control for gene expression analysis. Part of the Target Accelerator Plasmid Collection.DepositorAvailable SinceApril 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAAV.CAG.iAChSnFR-NULL
Plasmid#137956PurposeExpresses iAChSnFR (non-binding variant) under CAG promoterDepositorArticleInsertiAChSnFR (non-binding variant)
UseAAVExpressionMammalianMutationY140A binding site mutantPromoterCAGAvailable SinceFeb. 11, 2020AvailabilityAcademic Institutions and Nonprofits only -
pDONR223_DOK1_WT
Plasmid#82884PurposeGateway Donor vector containing DOK1, part of the Target Accelerator Plasmid Collection.DepositorAvailable SinceApril 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
pDONR223_CCND1_WT
Plasmid#82891PurposeGateway Donor vector containing CCND1, part of the Target Accelerator Plasmid Collection.DepositorAvailable SinceApril 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
pDONR223_FCGR3B_WT
Plasmid#82896PurposeGateway Donor vector containing FCGR3B, part of the Target Accelerator Plasmid Collection.DepositorAvailable SinceApril 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
p21-HA(dPCNA)-NeoR
Plasmid#215108PurposeExpresses p21-HA(dPCNA) in mammalian cells.DepositorInsertCDKN1A (CDKN1A Human)
TagsHAExpressionMammalianMutationp21(dPCNA) denotes mutations M147A, D149A, F150A.PromoterCMVAvailable SinceApril 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
pGEX-6p-1_GST-DmKHC[1-421]_1xmNeonGreen
Plasmid#196974PurposeBacterial expression plasmid for GST-based purification of Drosophila melanogaster kinesin heavy chain [1-421] with C-terminal mNeonGreen tag and cleavable N-terminal GST tagDepositorAvailable SinceJuly 20, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shB3GNT5.1
Plasmid#110325PurposeTRCN0000034809 (Target GCCTATGTAATCTCCGGTGAT), silence human B3GNT5 gene and express monomeric Kusabira-Orange2DepositorInsertB3GNT5 (B3GNT5 Human)
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceJune 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pGL3-sgRANGAP.C1-CAG-Cas9-T2A-mCherry-P2A-Puro
Plasmid#216249PurposeExpress Cas9 with CAG promoter to improve the expression in hES cells and sgRANGAP.C1 to tag endogenous RANGAP1 C-terminusDepositorInsertCas9 and sgRANGAP.C1 (RANGAP1 Human)
UseCRISPR; Endogenous taggingExpressionMammalianPromoterCAGAvailable SinceMarch 27, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDONR223_PIH1D1_WT_V5
Plasmid#82943PurposeGateway Donor vector containing PIH1D1, used as an over expression control for gene expression analysis. Part of the Target Accelerator Plasmid Collection.DepositorInsertPIH1D1 (PIH1D1 Human)
UseGateway entry vectorMutationM9L, G10E, V224I, P287LPromoterNoneAvailable SinceApril 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
pDONR223_RNH1_WT_V5
Plasmid#82995PurposeGateway Donor vector containing RNH1, used as an over expression control for gene expression analysis. Part of the Target Accelerator Plasmid Collection.DepositorAvailable SinceApril 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
pDONR223_EGFR_p.D837A
Plasmid#82912PurposeGateway Donor vector containing EGFR, part of the Target Accelerator Plasmid Collection.DepositorAvailable SinceOct. 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
TRCN0000338399
Plasmid#78156PurposeshXPO1 targeting CDSDepositorAvailable SinceJune 22, 2016AvailabilityAcademic Institutions and Nonprofits only -
pDONR223_RALA_WT_V5
Plasmid#82988PurposeGateway Donor vector containing RALA, used as an over expression control for gene expression analysis. Part of the Target Accelerator Plasmid Collection.DepositorAvailable SinceApril 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
FFSS-Cyclin D1-NeoR
Plasmid#215087PurposeExpresses FFSS-Cyclin D1 in mammalian cells.DepositorAvailable SinceApril 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
pGL3-basic-FTO promoter_WT
Plasmid#108922PurposeThe core promoter region of FTO was inserted into pGL3 basic vectorDepositorAvailable SinceMay 30, 2018AvailabilityAcademic Institutions and Nonprofits only -
t1-405
Plasmid#166127PurposeFor expression of human talin-1 head (residues 1-405) in E. coli. N-terminal His6-tag, Xpress-epitope (DLYDDDDK) and enterokinase cleavage site for tag removal.DepositorInsertTln1Head (1-405) (TLN1 Human)
TagsHis6-tag, Xpress-epitope (DLYDDDDK) and enterokin…ExpressionBacterialMutationresidues 1-405 onlyAvailable SinceApril 13, 2021AvailabilityAcademic Institutions and Nonprofits only