We narrowed to 10,837 results for: yeast
-
Plasmid#166838PurposeExpresses a palmitoylation mutant Vac8-GFP in yeasts, mutations are Cys4Ala, Cys5Ala, Cys7AlaDepositorInsertVAC8 (VAC8 Budding Yeast)
TagsGFPExpressionYeastMutationC4A, C5A, C7APromoterVAC8 promoterAvailable sinceApril 2, 2021AvailabilityAcademic Institutions and Nonprofits only -
pRS405 VAC8-G2A-GFP
Plasmid#166837PurposeExpresses a myristoylation mutant Vac8-GFP in yeasts, mutation is Gly2AlaDepositorAvailable sinceApril 2, 2021AvailabilityAcademic Institutions and Nonprofits only -
pNTI733 pRPR1(TetO)-RPC31-sgRNA
Plasmid#164913PurposeFor yeast genomic integration of sgRNA against RPC31DepositorInsertpRPR1(TetO)-RPC31-sgRNA
UseCRISPRExpressionYeastPromoterRPR1Available sinceFeb. 18, 2021AvailabilityAcademic Institutions and Nonprofits only -
pNTI732 pRPR1(TetO)-HTS1-sgRNA
Plasmid#164912PurposeFor yeast genomic integration of sgRNA against HTS1DepositorInsertpRPR1(TetO)-HTS1-sgRNA
UseCRISPRExpressionYeastPromoterRPR1Available sinceFeb. 18, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCSJ182
Plasmid#159723PurposeExpress Gid4 (YBR105C) in yeast two hybrid plasmid, pGADCgDepositorInsertGID4 (VID24 Budding Yeast)
UseYeast two-hybrid assayTags3xflag and Gal4ADExpressionYeastMutationremove stop codonPromoterADH1Available sinceOct. 2, 2020AvailabilityAcademic Institutions and Nonprofits only -
pBTMcC24-DM
Plasmid#111236Purposeyeast expression vectorDepositorInsertccdB-cassette
ExpressionYeastAvailable sinceAug. 13, 2019AvailabilityAcademic Institutions and Nonprofits only -
pRPL28 SpHIS5 (pNTI663)
Plasmid#115433PurposeExpresses wild-type RPL28 from HIS3 yeast plasmidDepositorInsertsExpressionYeastMutationMfeI site in intronPromoterAshbya gospii TEF1 and endogenousAvailable sinceOct. 24, 2018AvailabilityAcademic Institutions and Nonprofits only -
pRPL28(Q38P) SpHIS5 (pNTI664)
Plasmid#115434PurposeExpresses Q38P RPL28 from HIS3 yeast plasmidDepositorInsertsExpressionYeastMutationQ38P; MfeI site in intronPromoterAshbya gospii TEF1 and endogenousAvailable sinceOct. 24, 2018AvailabilityAcademic Institutions and Nonprofits only -
pRPL28(H39L) SpHIS5 (pNTI665)
Plasmid#115435PurposeExpresses H39L RPL28 from HIS3 yeast plasmidDepositorInsertsExpressionYeastMutationH39L; MfeI site in intronPromoterashbya gospii TEF1 and endogenousAvailable sinceOct. 24, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCBDU-JW
Plasmid#111237Purposeyeast expression vectorDepositorInsertccdB-cassette
ExpressionYeastAvailable sinceAug. 24, 2018AvailabilityAcademic Institutions and Nonprofits only -
pDR-AmTrac-GS
Plasmid#47769Purposeexpresses AmTrac-GS in yeastDepositorPublicationInsertAmTrac-GS
TagsmcpGFPExpressionYeastPromoterPMAAvailable sinceSept. 17, 2013AvailabilityAcademic Institutions and Nonprofits only -
pFA5
Plasmid#46791PurposeTo express a version of Fun30 without CUE domain in budding yeastDepositorAvailable sinceAug. 8, 2013AvailabilityAcademic Institutions and Nonprofits only -
pFA12
Plasmid#46792PurposeTo express a version of Fun30 with a mutated CUE domain in budding yeastDepositorAvailable sinceAug. 8, 2013AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-HIS3b
Plasmid#87402PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting HIS3b sequence AATATAGAGTGTACTAGAGG in yeast chromosome 15.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting HIS3b
UseCRISPRPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS208a
Plasmid#87383PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS208a sequence GTCCGCTAAACAAAAGATCT in yeast chromosome 2.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS208a
UseCRISPRPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS416d
Plasmid#87386PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS416d sequence TAGTGCACTTACCCCACGTT in yeast chromosome 4.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS416d
UseCRISPRPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCfB2903(XI-2 MarkerFree)
Plasmid#73275PurposeEasyClone-MarkerFree backbone vector for the addition of 1 or 2 genes and promoters for integration into site XI-2 (Chr XI: 91575..92913)DepositorTypeEmpty backboneUseCRISPR and Synthetic BiologyExpressionYeastAvailable sinceNov. 23, 2016AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pCfB2899(X-2 MarkerFree)
Plasmid#73271PurposeEasyClone-MarkerFree backbone vector for the addition of 1 or 2 genes and promoters for integration into site X-2 (Chr X: 194944..195980)DepositorTypeEmpty backboneUseCRISPR and Synthetic BiologyExpressionYeastAvailable sinceNov. 23, 2016AvailabilityAcademic Institutions and Nonprofits only -
p4A8_S7T_BC
Plasmid#217832Purpose4A8 variant in barcoded, yeast surface display plasmidDepositorInsert4A8 variant Fab
ExpressionYeastMutationVL: S7TAvailable sinceApril 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
pYSD_kappa_mRFP
Plasmid#217830PurposeYeast surface display Fab vector with kappa light chain and mRFPDepositorTypeEmpty backboneExpressionYeastAvailable sinceApril 22, 2024AvailabilityAcademic Institutions and Nonprofits only