We narrowed to 6,963 results for: crispr cas9 plasmids
-
Plasmid#215153PurposeExpresses gRNA targeting CCND1 and pSpCas9(BB)-2A-GFP in mammalian cells from the px458 vector.DepositorInserthSpCas9
UseCRISPRTags3XFLAG and GFPExpressionMammalianPromoterCbhAvailable SinceApril 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
KJ901: pMAGIC (R4-R3) NLS-(SrfI/PmeI)-NLS
Plasmid#121835PurposepMAGIC R4-R3 entry plasmid, contains 2x NLS scaffold enabling addition of dCas9 mutants into pMAGIC. dCas9 can be inserted via unique SrfI/PmeI restriction sitesDepositorTypeEmpty backboneUseSynthetic Biology; Pmagic gateway entry plasmidAvailable SinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
KL101: pMAGIC (R4-R3) NLS-(SrfI/PmeI)-NLS-KRAB
Plasmid#121837PurposepMAGIC R4-R3 entry plasmid, contains 2x NLS/KRAB scaffold enabling addition of dCas9 mutants into pMAGIC. dCas9 can be inserted via unique SrfI/PmeI restriction sitesDepositorTypeEmpty backboneUseSynthetic Biology; Pmagic gateway entry plasmidAvailable SinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
peSCBE3-NG
Plasmid#218163PurposeThis plasmid harbors the base editor eSCBE3-NG along with an sgRNA cloning cassette, facilitating high-efficiency cytosine base editing at targets bearing NG PAM in Streptomyces.DepositorInsertsescbe3-NG
a programmable sgRNA cloning cassette
UseCRISPR; Sgrna transcriptionExpressionBacterialMutationMutation in the portion of deaminase hAPOBEC3A : …PromoterrpsL promoterAvailable SinceMay 13, 2024AvailabilityAcademic Institutions and Nonprofits only -
pX462-hPRKAA2-gRNA_A
Plasmid#74376PurposegRNA_A to knockout human AMPK alpha 2 using Cas9n.DepositorAvailable SinceApril 27, 2016AvailabilityAcademic Institutions and Nonprofits only -
pX462-hPRKAA2-gRNA_B
Plasmid#74377PurposegRNA_B to knockout human AMPK alpha 2 using Cas9nDepositorAvailable SinceApril 14, 2016AvailabilityAcademic Institutions and Nonprofits only -
pSCBE3-HF1-Hypa
Plasmid#218158PurposeThis plasmid harbors the base editor SCBE3-HF1-Hypa along with an sgRNA cloning cassette, facilitating high-fidelity cytosine base editing in Streptomyces.DepositorInsertsscbe3-HF1-Hypa
a programmable sgRNA cloning cassette
UseCRISPR; Sgrna transcriptionExpressionBacterialMutationMutations in the portion of SpCas9 : D10A / N497A…PromoterrpsL promoterAvailable SinceMay 13, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSCBE3-NG-HF1
Plasmid#218160PurposeThis plasmid harbors the base editor SCBE3-NG-HF1 along with an sgRNA cloning cassette, facilitating high-fidelity cytosine base editing at targets bearing NG PAM in Streptomyces.DepositorInsertsscbe3-NG-HF1
a programmable sgRNA cloning cassette
UseCRISPR; Sgrna transcriptionExpressionBacterialMutationMutations in the portion of SpCas9 : D10A / N497A…PromoterrpsL promoterAvailable SinceMay 13, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSCBE3-NG-Hypa
Plasmid#218161PurposeThis plasmid harbors the base editor SCBE3-NG-Hypa along with an sgRNA cloning cassette, facilitating high-fidelity cytosine base editing at targets bearing NG PAM in Streptomyces.DepositorInsertsscbe3-NG-Hypa
a programmable sgRNA cloning cassette
UseCRISPR; Sgrna transcriptionExpressionBacterialMutationMutations in the portion of SpCas9 : D10A / N692A…PromoterrpsL promoterAvailable SinceMay 13, 2024AvailabilityAcademic Institutions and Nonprofits only -
PX459 mDnd1#1
Plasmid#106345Purposesmall guide RNA #1 against RRM-coding region of Dnd1 gene locusDepositorAvailable SinceMarch 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
PX459 mDnd1#2
Plasmid#106346Purposesmall guide RNA #2 against RRM-coding region of Dnd1 gene locusDepositorAvailable SinceMarch 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
PX459 mDnd1#3
Plasmid#106347Purposesmall guide RNA #3 against RRM-coding region of Dnd1 gene locusDepositorAvailable SinceMarch 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
peSCBE3-NG-Hypa
Plasmid#218165PurposeThis plasmid harbors the base editor eSCBE3-NG-Hypa along with an sgRNA cloning cassette, facilitating high-efficiency and high-fidelity cytosine base editing at targets bearing NG PAM in StreptomycesDepositorInsertsescbe3-NG-Hypa
a programmable sgRNA cloning cassette
UseCRISPR; Sgrna transcriptionExpressionBacterialMutationMutation in the portion of deaminase hAPOBEC3A : …PromoterrpsL promoterAvailable SinceMay 13, 2024AvailabilityAcademic Institutions and Nonprofits only -
peSCBE3-NG-HF1
Plasmid#218164PurposeThis plasmid harbors the base editor eSCBE3-NG-HF1 along with an sgRNA cloning cassette, facilitating high-efficiency and high-fidelity cytosine base editing at targets bearing NG PAM in Streptomyces.DepositorInsertsescbe3-NG-HF1
a programmable sgRNA cloning cassette
UseCRISPR; Sgrna transcriptionExpressionBacterialMutationMutation in the portion of deaminase hAPOBEC3A : …PromoterrpsL promoterAvailable SinceMay 13, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSCBE3-NG-HF1-Hypa
Plasmid#218162PurposeThis plasmid harbors the base editor SCBE3-NG-HF1-Hypa along with an sgRNA cloning cassette, facilitating high-fidelity cytosine base editing at targets bearing NG PAM in Streptomyces.DepositorInsertsscbe3-NG-HF1-Hypa
a programmable sgRNA cloning cassette
UseCRISPR; Sgrna transcriptionExpressionBacterialMutationMutations in the portion of SpCas9 : D10A / N497A…PromoterrpsL promoterAvailable SinceMay 13, 2024AvailabilityAcademic Institutions and Nonprofits only -
BPK1520_puroR
Plasmid#173901PurposeSpCas9 guide cloning vector derived from BPK1520 that allows for puromycin-based selectionDepositorTypeEmpty backboneUseCRISPRExpressionMammalianPromoterCMV/U6Available SinceNov. 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
LCV2_PSMB2_sgRNA_1
Plasmid#155092Purposelentiviral plasmid expressing Cas9 and gRNA targeting PSMB2 (core essential gene)DepositorInsertPSMB2_sgRNA_1 (PSMB2 Human)
UseCRISPR and LentiviralExpressionMammalianPromoterU6 promoterAvailable SinceAug. 7, 2020AvailabilityAcademic Institutions and Nonprofits only -
pEJS-HZ79 All-in-one AAV-U1a-NmeABE8e-2xBPSV40-U6-Rosa26_V2
Plasmid#199261PurposeOptimized single AAV vector for expressing N-terminal fusion Nme2Cas9-ABE8e and one U6 driven sgRNA targeting mouse Rosa26 gene. This optimized construct showed improved in vivo editing efficiency.DepositorInsertNmeABE8e
UseAAV and CRISPRTagsNLSExpressionMammalianPromoterU1a promoterAvailable SinceApril 10, 2023AvailabilityAcademic Institutions and Nonprofits only -
PX459v2-ILK-gRNA 1-exon 1
Plasmid#163320PurposeSpCas9 ILK gRNA 1 (G*CGGAGAACGACCTCAACCAG), targeting exon 1 within the N-terminal ankyrin repeat domain-1.DepositorInsertILK gRNA 1_Exon1
UseCRISPRExpressionMammalianPromoterU6Available SinceJan. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
PX459v2-ILK-gRNA 2-exon 8
Plasmid#163321PurposeSpCas9 ILK gRNA 2 (G*ACATTGTAGAGGGATCCATA), targeting exon 8 within the C-terminal protein kinase domain.DepositorInsertILK gRNA 2_Exon8
UseCRISPRExpressionMammalianPromoterU6FAvailable SinceJan. 7, 2022AvailabilityAcademic Institutions and Nonprofits only