We narrowed to 7,015 results for: tac
-
Plasmid#173574PurposeExpresses a Arid1b-targeting gRNA and Cre-recombinaseDepositorInsertgRNA targeting Arid1b (Arid1b Mouse)
UseCRISPR, Cre/Lox, and LentiviralAvailable SinceJune 29, 2022AvailabilityAcademic Institutions and Nonprofits only -
FGFR2 gRNA (BRDN0001147365)
Plasmid#76183Purpose3rd generation lentiviral gRNA plasmid targeting human FGFR2DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pLD-puro-Cc-PARK7WT-VA
Plasmid#115182PurposeLentiviral transduction and expression of PARK7WT into any mammalian cellDepositorInsertPARK7WT (PARK7 Human)
UseLentiviralTagsVersatile affinity tag (2XStreptactin II-6XHis-3X…PromoterCMVAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
AURKB gRNA (BRDN0001149202)
Plasmid#77617Purpose3rd generation lentiviral gRNA plasmid targeting human AURKBDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pXPR_BRD003-sgWRN2
Plasmid#125772Purposeconstitutive expression of a guide RNA targeting human WRNDepositorInsertsgWRN2 (WRN Human)
UseCRISPRAvailable SinceMay 29, 2019AvailabilityAcademic Institutions and Nonprofits only -
LCV2_PSMD1_sgRNA_1
Plasmid#155091Purposelentiviral plasmid expressing Cas9 and gRNA targeting PSMD1 (core essential gene)DepositorInsertPSMD1_sgRNA_1 (PSMD1 Human)
UseCRISPR and LentiviralExpressionMammalianPromoterU6 promoterAvailable SinceAug. 7, 2020AvailabilityAcademic Institutions and Nonprofits only -
HK2 gRNA (BRDN0001162355)
Plasmid#76311Purpose3rd generation lentiviral gRNA plasmid targeting human HK2DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pGG369
Plasmid#165606PurposeVector for expression of ω-dCas9 and sgRNA in E. coli: lacUV2-ω-1xFLAG-dCas9(Wt PID)-1xNLS-3xHA-1xNLS and UV5-BsaI-sgRNA (BsaI sites in place of the spacer)DepositorInsertω-1xFLAG-dCas9(PAM-interacting domain and overall coding scheme from Wt SpCas9)-1xNLS-3xHA-1xNLS and BsaI-sgRNA
UseCRISPR and Synthetic BiologyTags1x FLAG, 3x HA, Omega (ω) subunit of RNA polymera…ExpressionBacterialMutationRecoding of BsaI site in the AmpR cassette, two B…PromoterlacUV2 driving ω-dCas9 and UV5 driving sgRNAAvailable SinceApril 21, 2021AvailabilityAcademic Institutions and Nonprofits only -
LCV2_mCherry_PSMD1_sgRNA_1
Plasmid#155107Purposelentiviral plasmid expressing mCherry, Cas9 and a gRNA targeting PSMD1 (core essential gene)DepositorInsertPSMD1_sgRNA_1 (PSMD1 Human)
UseCRISPR and LentiviralExpressionMammalianPromoterU6 promoterAvailable SinceAug. 7, 2020AvailabilityAcademic Institutions and Nonprofits only -
px330-Apob-4
Plasmid#162551PurposesgRNA targeting ApobDepositorAvailable SinceFeb. 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
TET-pLKO.1 PURO shGDF11 #1
Plasmid#83083PurposeLentiviral shRNA vector for inducible knockdown of human GDF11 (cross reacts with mouse Gdf11)DepositorAvailable SinceFeb. 28, 2019AvailabilityAcademic Institutions and Nonprofits only -
CSF1R gRNA (BRDN0001146892)
Plasmid#77039Purpose3rd generation lentiviral gRNA plasmid targeting human CSF1RDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
TTN gRNA (BRDN0001145502)
Plasmid#76851Purpose3rd generation lentiviral gRNA plasmid targeting human TTNDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
TTN gRNA (BRDN0001148106)
Plasmid#76854Purpose3rd generation lentiviral gRNA plasmid targeting human TTNDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
TAF1 gRNA (BRDN0001145163)
Plasmid#77871Purpose3rd generation lentiviral gRNA plasmid targeting human TAF1DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
Ikaros-CRISPR-Nick 1/2 (PX461-EF1a-pSpCas9n(BB)-2A-GFP)
Plasmid#75242PurposeCRISPR/Cas9 NICKASE plasmid against human Ikaros (1/2)DepositorInsertsgRNA against human Ikaros (IKZF1 Human)
UseCRISPRAvailable SinceJune 8, 2016AvailabilityAcademic Institutions and Nonprofits only -
CSNK1E gRNA (BRDN0001147318)
Plasmid#77977Purpose3rd generation lentiviral gRNA plasmid targeting human CSNK1EDepositorInsertUseCRISPR and LentiviralExpressionMammalianPromoterhU6Available SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
MAP2K4 gRNA (BRDN0001148854)
Plasmid#76652Purpose3rd generation lentiviral gRNA plasmid targeting human MAP2K4DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
MB 39Vm13 ttrSR(m13)-bARGSer
Plasmid#232472PurposeOptimized tetrathionate sensor with acoustic reporter genes (bARGSer)DepositorInsertsttrS
ttrR
PttrB185-269
bARGSer
AxeTxe
ExpressionBacterialMutationthe gene Ser39006_001280 was deleted from the clu…PromoterConstitutive (TTGATAGCTAGCTCAGTCCTAGGTATTGTGCTAGC…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
Mirror GFP[ENE(C8351G)-mascRNA(mut 8356-8370)](pAVA3871)
Plasmid#239352PurposeExpresses TEV protease and tandemly-repeated GFP fluorescent proteins to amplify the fluorescence signal produced by a single transcription unit of MALAT1 ENE(C8351G)-mascRNA(mut 8356-8370) reporter.DepositorInsertMALAT1 ENE(C8351G)-mascRNA(mut 8356-8370)
ExpressionMammalianMutationMALAT1 ENE(C8351G)-mascRNA(mut 8356-8370: ctacgac…Available SinceAug. 26, 2025AvailabilityAcademic Institutions and Nonprofits only