We narrowed to 21,831 results for: SPR
-
Viral Prep#247027-LVPurposeReady-to-use Lentiviral Prep particles produced from Jacquere (all-in-one vector) (#247027). In addition to the viral particles, you will also receive purified Jacquere (all-in-one vector) plasmid DNA.DepositorAvailable SinceMay 11, 2026AvailabilityAcademic Institutions and Nonprofits only
-
pLenti-dCas9-KRAB-gRNA-TRE-blast
Plasmid#201152PurposeLentiviral expression of S. pyogenes dead Cas9 (dCas9/dSpCas9/SpdCas9) fused to the KRAB domain as well as a gRNA targeting the tight TRE promoter and the blasticidin resistance gene.DepositorInsertsdCas9-KRAB
gRNA-TRE
UseCRISPR and LentiviralTagsHAMutationgRNA sequence: TACGTTCTCTATCACTGATAvailable SinceJuly 25, 2023AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(hYAP1-Y2B)-PGKpuro2AmCherry-W
Plasmid#163179PurposeLentiviral gRNA plasmid targeting human YAP1 gene, co-expression of mCherry tagDepositorAvailable SinceFeb. 19, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCRI009-pKW20088-PelcA-mCherry-TtrpC-NotI-PacI
Plasmid#140202PurposeCRISPRa proof-of-concept test target with fluorescent reporter. PelcA is fused to mCherry, with low basal expression in Aspergillus nidulans. Fungal vector with AMA1 and pyrG selection marker.DepositorInsertmCherry
UseCRISPR and Synthetic Biology; Proof-of-concept te…MutationG174DPromoterPelcAAvailable SinceSept. 11, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSCIP-hCD69-TdTomato
Plasmid#154095PurposeSelf-Cutting and Integrating CRISPR backbone targeting human CD69 promoter with TdTomato reporter transgeneDepositorInserts[5HA]-P2A-tdTomato-[3HA]
hCD69 targeting sgRNA - AGCTCTTTGCATCCGGAGAG
UseCRISPRExpressionMammalianAvailable SinceJuly 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
ACTB-PQR-RFPnols-PQR-loxP-Zeo-loxP
Plasmid#121448PurposeTo make a stable human recombinant cell line; see right thumbnail map image for PQR annotationsDepositorAvailable SinceApril 29, 2019AvailabilityAcademic Institutions and Nonprofits only -
pYZ145
Plasmid#98405PurposeDonor DNA plasmid to introduce leu1 deletion in S. pombe. Linearization with Not1 digestion.DepositorInsertsUseCRISPR and Synthetic BiologyAvailable SinceFeb. 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
pYZ149
Plasmid#98407PurposeDonor DNA plasmid to introduce his3 deletion in S. pombe. Linearization with Not1 digestion.DepositorInsertsUseCRISPR and Synthetic BiologyAvailable SinceFeb. 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
CEP55 B12.2 gRNA
Plasmid#90623Purpose3rd generation lentiviral gRNA plasmid targeting human CEP55DepositorInsertCEP55 (Guide Designation B12.2)
UseCRISPR and LentiviralPromoterU6Available SinceNov. 15, 2017AvailabilityAcademic Institutions and Nonprofits only -
FOXM1 C11.2 gRNA
Plasmid#90690Purpose3rd generation lentiviral gRNA plasmid targeting human FOXM1DepositorInsertFOXM1 (Guide Designation C11.2)
UseCRISPR and LentiviralPromoterU6Available SinceAug. 8, 2017AvailabilityAcademic Institutions and Nonprofits only -
ANLN A2.2 gRNA
Plasmid#90531Purpose3rd generation lentiviral gRNA plasmid targeting human ANLNDepositorInsertANLN (Guide Designation A2.2)
UseCRISPR and LentiviralPromoterU6Available SinceAug. 2, 2017AvailabilityAcademic Institutions and Nonprofits only -
DKC1 F1.3 gRNA
Plasmid#90652Purpose3rd generation lentiviral gRNA plasmid targeting human DKC1DepositorInsertDKC1 (Guide Designation F1.3)
UseCRISPR and LentiviralPromoterU6Available SinceJuly 20, 2017AvailabilityAcademic Institutions and Nonprofits only -
CEP55 B11.2 gRNA
Plasmid#90622Purpose3rd generation lentiviral gRNA plasmid targeting human CEP55DepositorInsertCEP55 (Guide Designation B11.2)
UseCRISPR and LentiviralPromoterU6Available SinceJuly 20, 2017AvailabilityAcademic Institutions and Nonprofits only -
FEN1 C10.3 gRNA
Plasmid#90689Purpose3rd generation lentiviral gRNA plasmid targeting human FEN1DepositorInsertFEN1 (Guide Designation C10.3)
UseCRISPR and LentiviralPromoterU6Available SinceJuly 19, 2017AvailabilityAcademic Institutions and Nonprofits only -
VCP F12.4 gRNA
Plasmid#90939Purpose3rd generation lentiviral gRNA plasmid targeting human VCPDepositorInsertVCP (Guide Designation F12.4)
UseCRISPR and LentiviralPromoterU6Available SinceJuly 19, 2017AvailabilityAcademic Institutions and Nonprofits only -
VCP F11.4 gRNA
Plasmid#90938Purpose3rd generation lentiviral gRNA plasmid targeting human VCPDepositorInsertVCP (Guide Designation F11.4)
UseCRISPR and LentiviralPromoterU6Available SinceJuly 18, 2017AvailabilityAcademic Institutions and Nonprofits only -
ALDH18A1 gRNA (BRDN0001149056)
Plasmid#77994Purpose3rd generation lentiviral gRNA plasmid targeting human ALDH18A1DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
TRIM24 gRNA (BRDN0001146855)
Plasmid#77886Purpose3rd generation lentiviral gRNA plasmid targeting human TRIM24DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
CCL2 gRNA (BRDN0001148290)
Plasmid#77867Purpose3rd generation lentiviral gRNA plasmid targeting human CCL2DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
TRIM33 gRNA (BRDN0001162242)
Plasmid#77099Purpose3rd generation lentiviral gRNA plasmid targeting human TRIM33DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only