We narrowed to 19,869 results for: INO
-
Plasmid#124278PurposeExpresses mouse GIRK2 R201A as a TEV protease cleavable C-terminal fusion to eGFP, strep tag II, and 6x His tagDepositorAvailable SinceApril 16, 2019AvailabilityAcademic Institutions and Nonprofits only
-
pRK5-HA-FLCN (C terminus)
Plasmid#72297PurposeoverexpressionDepositorInsertFLCN C-terminus (FLCN Human)
TagsHAExpressionMammalianMutationContains only C terminus of FLCN as defined in PM…PromoterCMVAvailable SinceFeb. 2, 2016AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-DTYMK
Plasmid#100546Purposemammalian expression of deoxythymidylate kinaseDepositorInsertdeoxythymidylate kinase (DTYMK Human)
ExpressionMammalianAvailable SinceSept. 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCMVTNT-EPHX1
Plasmid#53114PurposeIn vitro translation of microsomal epoxide hydrolaseDepositorAvailable SinceMay 7, 2014AvailabilityAcademic Institutions and Nonprofits only -
pCS2-mqgDUX4mqg*
Plasmid#21177DepositorInsertDUX4 (DUX4 Human)
ExpressionBacterial and MammalianMutationPoint mutation at nucleotide 6163 (numbering acco…Available SinceJuly 22, 2009AvailabilityAcademic Institutions and Nonprofits only -
pEF5/FRT/DEST-3xHA/mGli2 P1-4A
Plasmid#51252PurposeEncodes N-3xHA-TEV-mouseGli2-C; amino acids 789,805,817,848 mutated to AlaDepositorInsertGli2 (Gli2 Mouse)
UseFlpin systemTags3xHA-TEVExpressionMammalianMutationamino acids 789,805,817,848 mutated to AlaPromoterEF1aAvailable SinceFeb. 25, 2014AvailabilityAcademic Institutions and Nonprofits only -
pT7-7 asyn S87A
Plasmid#36058DepositorAvailable SinceJuly 13, 2012AvailabilityAcademic Institutions and Nonprofits only -
pcDNA-hDDB2-R273H-V5
Plasmid#167469Purposeectopic expression of hDDB2 in mammalian cellsDepositorAvailable SinceApril 21, 2021AvailabilityAcademic Institutions and Nonprofits only -
pSUMO His6 SUMO SnRK2.2 (20-362)
Plasmid#177845PurposeBacterial Expression of SnRK2.2DepositorAvailable SinceDec. 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
STARR-seq luciferase validation vector_mP_SV40
Plasmid#99310PurposeLuciferase validation vector with SV40 enhancer inserted downstream of the reporter gene. The candidate's enhancer activity is reflected by luciferase activityDepositorInsertSV40 enhancer
UseLuciferase; Starr-seq luciferase validation vectorExpressionMammalianAvailable SinceSept. 26, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCVL.SSA TLR (CCR5 TALEN Sce Spacer)
Plasmid#46941PurposeCodes for the SSA-TLR with the target site for the CCR5 TALEN with the spacer region corresponding to I-Sce I in a lentiviral backboneDepositorInserts5' iRFP arm
eGFP with TALEN TS
+3 mCherry
3' iRFP arm
UseLentiviralExpressionBacterial and MammalianMutationembedded TALEN TS from 163-218, truncated 25 amin…PromoterSFFVAvailable SinceNov. 4, 2013AvailabilityAcademic Institutions and Nonprofits only -
3xNLS-NLP-cMyc-cMyc enAspCas12a
Plasmid#182127PurposepET21a protein expression vector for 3xNLS-NLP-cMyc-cMyc enAspCas12a in bacteriaDepositorInsert3xNLS-NLP-cMyc-cMyc enAspCas12a
Tags6xHisExpressionBacterialPromoterT7Available SinceSept. 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
His6-SMT3-SopB
Plasmid#183676PurposeRecombinant Salmonella Typhimurium SopBDepositorInsertsopB (sopB Salmonella enterica serovar Typhimurium, Budding Yeast)
TagsHis6-S. cerevisiae SMT3(2-101)ExpressionBacterialPromoterT7Available SinceMay 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
pT5T_hp53_ST_CR2
Plasmid#34923DepositorInsertp53 DNA-binding (Res 94-358, deletion 293-321) (TP53 Human)
ExpressionBacterialMutationC135V, C141V, W146Y, C182S, V203A, R209P, C229Y, …PromoterT7Available SinceFeb. 22, 2012AvailabilityAcademic Institutions and Nonprofits only -
pAAV_Donor/Reporter-COL4A5
Plasmid#130280PurposeCOL4A5 mutation-specific sgRNA under the control of U6 promoter; mCherry-sgRNA target-(out of frame)EGFP expression cassette; COL4A5 donor templateDepositorInsertmCherry-eGFP
UseAAVPromoterCMVAvailable SinceDec. 15, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-dSa VP64 Actc1
Plasmid#99691PurposeExpresses dSa Cas9 fused to gold standard VP64 activator domain and Sa sgRNA for Actc1 promoter, vector allows for activation of mouse Actc1, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Actc1 (gRNA sequence: GCCATTCTTGGAGCCAAGGG) (Actc1 Synthetic, Mouse)
UseAAV and CRISPRTagsVP64Mutationdead Cas9Available SinceDec. 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEMS2116
Plasmid#49141PurposeThe plasmid contains the Pleaides (Ple) MiniPromoter Ple155 derived from the human PCP2 gene and designed for expression in ON Bipolar cells of the retina.DepositorInsertssAAV-Ple155-emGFP
UseAAVExpressionMammalianPromoterMiniPromoter Ple155 from the human PCP2 geneAvailable SinceMay 10, 2016AvailabilityIndustry, Academic Institutions, and Nonprofits -
ptdTomato-N1-CMVL-ikk1FL(C179A)-tdTomato
Plasmid#105644PurposeZebrafish Inhibitor of kappa B kinase alpha with mutation at position 179 from cysteine to alanineDepositorInsertCMVL-ikk1FL(C179A)-tdTomato (chuk Zebrafish)
TagstdTomatoExpressionMammalianMutationCMV:ikk1FL(C178A)-tdTomatoAvailable SinceFeb. 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCGT-HCF-1-C600
Plasmid#99364PurposeC-term of HCFC1 proteinDepositorInsertHCF-1 C-term 1436-2035 (HCFC1 Human)
Tags2x tandem T7 tag and C-mycExpressionMammalianMutationDeletion of HCFC1 cDNAPromoterCMVAvailable SinceSept. 27, 2017AvailabilityAcademic Institutions and Nonprofits only -
3xNLS-NLP-cMyc-cMyc AspCas12a
Plasmid#182122PurposepET21a protein expression vector for 3xNLS-NLP-cMyc-cMyc AspCas12a in bacteriaDepositorInsert3xNLS-NLP-cMyc-cMyc AspCas12a
Tags6xHisExpressionBacterialPromoterT7Available SinceSept. 22, 2022AvailabilityAcademic Institutions and Nonprofits only