We narrowed to 14,567 results for: cas9 genes
-
Plasmid#193733PurposeExpresses deactivated-Cas9 (J23107) and tracrRNA, with BBR1 origin, ampR, Start-Stop assembly site for array insertionDepositorTypeEmpty backboneUseCRISPR and Synthetic BiologyExpressionBacterialAvailable SinceFeb. 16, 2023AvailabilityAcademic Institutions and Nonprofits only
-
pLD-puro-Cc-CR-PARK7WT-VA
Plasmid#115187PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PARK7WT into any mammalian cell (when using sgRNA seq agtacagtgtagccgtgatg)DepositorInsertCR (CRISPR/Cas9-resistant)-PARK7WT (PARK7 Human)
UseLentiviralTagsVersatile affinity tag (2XStreptactin II-6XHis-3X…Mutationc.150G>A (silent when translated to protein, c…PromoterCMVAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLD-puro-Cc-CR-PARK7V51G-VA
Plasmid#115188PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PARK7V51G into any mammalian cell (when using sgRNA seq agtacagtgtagccgtgatg)DepositorInsertCR (CRISPR/Cas9-resistant)-PARK7V51G (PARK7 Human)
UseLentiviralTagsVersatile affinity tag (2XStreptactin II-6XHis-3X…Mutationc.150G>A (silent when translated to protein, c…PromoterCMVAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLD-puro-Cc-CR-PARK7C53A-VA
Plasmid#115189PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PARK7C53A into any mammalian cell (when using sgRNA seq agtacagtgtagccgtgatg)DepositorInsertCR (CRISPR/Cas9-resistant)-PARK7C53A (PARK7 Human)
UseLentiviralTagsVersatile affinity tag (2XStreptactin II-6XHis-3X…Mutationc.150G>A (silent when translated to protein, c…PromoterCMVAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLD-puro-Cc-CR-PARK7H126A-VA
Plasmid#115190PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PARK7H126A into any mammalian cell (when using sgRNA seq agtacagtgtagccgtgatg)DepositorInsertCR (CRISPR/Cas9-resistant)-PARK7H126A (PARK7 Human)
UseLentiviralTagsVersatile affinity tag (2XStreptactin II-6XHis-3X…Mutationc.150G>A (silent when translated to protein, c…PromoterCMVAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLD-puro-Cc-CR-PARK7E163K-VA
Plasmid#115191PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PARK7E163K into any mammalian cell (when using sgRNA seq agtacagtgtagccgtgatg)DepositorInsertCR (CRISPR/Cas9-resistant)-PARK7E163K (PARK7 Human)
UseLentiviralTagsVersatile affinity tag (2XStreptactin II-6XHis-3X…Mutationc.150G>A (silent when translated to protein, c…PromoterCMVAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pORFE1001
Plasmid#112079PurposeOverexpression of the AtCAS9 in plant under 2x35S promoterDepositorInsertAtCAS9
UseCRISPRExpressionPlantMutationPlant codon optimized Cas9 S. pyogenesPromoter2x35SAvailable SinceAug. 10, 2018AvailabilityAcademic Institutions and Nonprofits only -
p35C-gRNA-ccdB
Plasmid#246792PurposeExpress gRNA in plant cells (protoplast or callus) for Cas9-mediated editingDepositorInsertccdB
UseCRISPRAvailable SinceMarch 17, 2026AvailabilityAcademic Institutions and Nonprofits only -
GA04
Plasmid#248860PurposeRetroviral vector encoding cas9-BFP-suntag of the modified casdrop systemDepositorInsertModified casdrop component 1
UseRetroviralAvailable SinceMarch 10, 2026AvailabilityAcademic Institutions and Nonprofits only -
CRISPi Kit
Plasmid Kit#1000000136PurposePlasmids for performing CRISPR/Cas9 mediated gene and genome editing in Pichia pastoris.DepositorApplicationGenome EditingVector TypeYeast ExpressionEditing TypeCRISPRAvailable SinceAug. 27, 2018AvailabilityAcademic Institutions and Nonprofits only -
pENTR-DMD-Donor
Plasmid#60605PurposeKnock-in donor vector to insert Exon 44 in front of Exon 45 of human DYSTROPHIN (DMD)gene, include EF1a-hygromycin resistance cassette flanked by loxP sequences.DepositorInsertHygromycin resistant gene
UseKnock-in donor vectorExpressionMammalianAvailable SinceDec. 15, 2014AvailabilityAcademic Institutions and Nonprofits only -
-
PB-iRFP-STOP-ReNL
Plasmid#113965PurposePiggybac transposon plasmid CRISPR gene deletion activatable fluorescence. Constitutive iRFP670 under EF1A promoter, CMV promoter with two SV40 polyA followed by red-enhanced nanolantern (ReNL)DepositorInsertsiRFP670
ReNL
UsePiggybac transposonExpressionMammalianPromoterCMV - SV40-PolyA - SV40-PolyA and EF1AAvailable SinceDec. 9, 2019AvailabilityAcademic Institutions and Nonprofits only -
pUS2-SH231
Plasmid#115150PurposeCas9-GFP, dual gRNA expression vector for targeted integration of repair templates into safe harbor 231 locus in chromosome 4DepositorInsertDual SH231 gRNAs
UseCRISPRTags3xFLAG-SV40NLS, GFP, and Nucleoplasmin NLSExpressionMammalianPromoterU6, CBhAvailable SinceOct. 10, 2018AvailabilityAcademic Institutions and Nonprofits only -
pUG-natNT2
Plasmid#110922Purposeexpression of nat gene conferring resistance to nourseothricin for gene deletion in yeastDepositorInsertnat
ExpressionBacterial and YeastPromoterAgTEF1Available SinceJune 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
pH-ABE8e-spG
Plasmid#200775PurposeFor plant adenine base editing in rice plants or monocotyledons protoplastsDepositorInsertnCas9-spG(D10A)-TadA8e
UseCRISPRExpressionPlantMutationD10A, D1135L, S1136W, G1218K, E1219Q, R1335Q, T13…Promotermaize Ubiquitin-1, OsU3Available SinceJuly 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
HR-TERT-SV40-GFP
Plasmid#71397PurposeHomologues recombination donor plasmid fo the TERT promotor region introducing a SV-40 driven GFP marker in the TERT promotor. Includes 1kb of TERT coding region in right homologues arm.DepositorInsertTERT (TERT Human)
TagsSV-40 GFP insertion in TERT promotorPromoterEndogenous TERT promotorAvailable SinceDec. 10, 2015AvailabilityAcademic Institutions and Nonprofits only -
FLAG-LoxP-PURO-LoxP-SNAP-TERT
Plasmid#71390PurposeHomologues recombination donor plasmid for inserting a FLAG-SNAP-tag at the N-terminus of the TERT locus in human cells. Includes PURO resistance flanked by LoxP sites for selection.DepositorAvailable SinceDec. 10, 2015AvailabilityAcademic Institutions and Nonprofits only -
loxP-G418-LoxP-TurboID-Rab11 HR
Plasmid#230026PurposeHomology repair plasmid for endogenous tagging of Rab11 at the N-terminus with TurboID and a V5 epitope tag. Contains a G418 resistance cassette for selection of edited cellsDepositorAvailable SinceJan. 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMB953:PB-CAG-PuroR-nGFP-FLEx-mCherry-KASH-WPRE
Plasmid#168106PurposePiggyBac transposon vector constitutively driving PuroR-P2A-eGFP and Cre conditional expression of KASH nuclear membrane-bound mCherry. Conditional insert flanked by MCS for cloningDepositorInsertmCherry-KASH
UseCRISPR and Cre/LoxPromoterCAGAvailable SinceMay 28, 2021AvailabilityAcademic Institutions and Nonprofits only