We narrowed to 10,561 results for: fus
-
Plasmid#217653PurposeExpresses the fusion of HyPer7,a H2O2 sensor, and Rhodotorula gracilis D amino acid oxidase (DAAO) to measure transport of D amino acids across the plasma membraneDepositorInsertHyPer7 D amino acid oxidase
UseLentiviralTagsNuclear export signalExpressionMammalianMutationFused DAAO to the C-terminus of HyPer7 using a Gl…PromoterCMVAvailable SinceDec. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRelA*
Plasmid#175590PurposeTet inducible, KAN Resistant, fluor labelled (YFP) synthesis domain of the E. coli relA gene on a low copy backbone. Used to induce controllable synthesis of ppGpp in E. coli.DepositorInsertCatalytic domain of E.coli relA gene.
TagsFused with a flexible GS linker to mVenusExpressionBacterialMutationOnly the catalytic domain of the enzyme is used (…Available SinceNov. 19, 2021AvailabilityAcademic Institutions and Nonprofits only -
px330-Axin1
Plasmid#162543PurposesgRNA targeting Axin1DepositorAvailable SinceFeb. 19, 2021AvailabilityAcademic Institutions and Nonprofits only -
pBigTB-ERT2CreERT2
Plasmid#149433Purposetamoxifen-inducible Cre recombinaseDepositorInsertERT2-Cre-ERT2 fusion protein
UseCre/Lox and Mouse TargetingTagsERT2ExpressionMammalianPromoterCAG promoterAvailable SinceSept. 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
GFP-S100A11
Plasmid#107201PurposeExpresses GFP-human S100A11 fusion protein for live cell imagingDepositorAvailable SinceJune 13, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-soCoChR-mCardinal
Plasmid#107713PurposeA somatic channelrhodopsin, which enables single cell, single millisecond resolution optogenetics. hSynapsin promoterDepositorInsertsoCoChR-mCardinal
UseAAVTagsKA2 and mCardinalExpressionMammalianPromoterhSynAvailable SinceMay 1, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCMV-Y-RAN-GFP26
Plasmid#106423PurposeY-RAN-GFP26 (RANbody GFP26::Chicken IgY)DepositorInsertY-RAN-GFP26
TagsHA and HisExpressionMammalianAvailable SinceFeb. 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pU6-(BbsI)sgRNA_CAG-Cas9-venus-bpA
Plasmid#86986PurposeFor cloning and expression of sgRNA together with expression of a Cas9-Venus fusion proteinDepositorInsertCas9-venus
TagsCas9-Venus fusion proteinExpressionMammalianPromoterCAGAvailable SinceApril 3, 2017AvailabilityAcademic Institutions and Nonprofits only -
pJZC25
Plasmid#62328PurposesgRNA + 1x MS2 with MCP-VP64 effector for mammalian cellsDepositorInsertssgRNA + 1x MS2 binding module
MCP-VP64
UseLentiviralTagsVP64ExpressionMammalianMutationTargets Tet3G, sequence: GTACGTTCTCTATCACTGATAPromoterCMV and U6Available SinceApril 2, 2015AvailabilityAcademic Institutions and Nonprofits only -
pCEP4-PDGFRA-reporter
Plasmid#136456PurposeMammalian fluorescent reporter plasmid for PDGFRA signaling.DepositorInsertsPDGFRalpha (PDGFRA Human)
Array of serum response elements (SRE) to drive destabilized GFP expression from a minimal promoter.
TagsExtracellular c-myc epitope tag, Signal peptide f…ExpressionMammalianPromoterCMV and Minimal promoter with artificial SRE enha…Available SinceJuly 9, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCAG-NLS(SV40)x2-rAPOBEC1-gs-XTEN-gs-hdenAsCas12a(E174R/S542R/K548R/D908A)-gs-UGI-NLS(SV40)(enAsBE1.4) (RTW1028)
Plasmid#114084PurposeCAG promoter expression plasmid for human codon optimized enAsBE1.4DepositorInsertDNase-inactive (D908A) enAsCas12a (E174R/S542R/K548R) fused to N-terminal rAPOBEC1 and C-terminal UGI (enAsBE1.4)
Tags2x SV40 NLS and SV40 NLSExpressionMammalianMutationE174R, S542R, K548R and D908A, human codon optimi…Available SinceDec. 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
pZP06C
Plasmid#232322PurposepZP06C was constructed by adding the mCherry reporter gene driven by the rpsJ promoter into pZP06B (containing PrpsJ-sacB) to facilitate the screening of positive clones through red fluorescence.DepositorInsertmCherry
ExpressionBacterialPromoterrpsJAvailable SinceMarch 12, 2025AvailabilityAcademic Institutions and Nonprofits only -
pBpuro_KLF4_ER
Plasmid#34609DepositorInsertKLF4 (KLF4 Human)
UseRetroviralTagsMyc epitope tag and estrogen receptor fusionExpressionMammalianPromoterLTRAvailable SinceJan. 24, 2012AvailabilityAcademic Institutions and Nonprofits only -
retro-puro vector
Plasmid#58250PurposeRetroviral expression vector encoding an empty IRES-Puromycin cassetteDepositorTypeEmpty backboneUseRetroviralExpressionMammalianAvailable SinceMarch 30, 2016AvailabilityAcademic Institutions and Nonprofits only -
pET24a-VHH-tev-mCherry
Plasmid#117752PurposeBacterial expression of a functionalized anti-GFP (VHH) nanobody fused to mCherry. VHH-mCherry also contains a T7, HA, BAP, tev cleavage site and His6 epitopeDepositorInsertanti-GFP nanobody fused to a T7, tev site, mCherry, HA, BAP and His6 epitope
TagsBAP, HA, His6, and T7ExpressionBacterialPromoterT7Available SinceFeb. 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
MLM3762
Plasmid#49947PurposeExpresses a mutant TALE-TET1CD (inactive catalytic domain of TET1) fusion protein engineered to bind a site in the human RHOXF2/2B homeobox (RHOXF2) gene for use as a controlDepositorInsert3x FLAG Tet1CDmut RH-4 (RHOXF2 Human)
UseTALENTags3x FLAGMutationcatalytic domain of TET1 inactive (H1671Y and D16…PromoterEF1aAvailable SinceDec. 31, 2013AvailabilityAcademic Institutions and Nonprofits only -
-
pMX-IY HA-GBRPL2
Plasmid#89298PurposeFor expression of the mammalian Atg8 protein GABARAPL2 tagged with HADepositorAvailable SinceApril 3, 2017AvailabilityAcademic Institutions and Nonprofits only -
pGL3Basic-ME.2/ApoEpromoter
Plasmid#51436PurposeThis plasmid is a luciferase-based reporter construct to measure the activity of the ApoE promoter fused to ME.2 enhancerDepositorUseLuciferaseExpressionMammalianMutationThe ME.2 enhancer is fused upstream of the ApoE g…Available SinceFeb. 27, 2014AvailabilityAcademic Institutions and Nonprofits only -
pGWB521
Plasmid#74863PurposeGateway cloning compatible binary vector for N-terminal fusion with 10xMyc (CaMV35S promoter).DepositorTypeEmpty backboneExpressionPlantPromoterCaMV35SAvailable SinceSept. 30, 2016AvailabilityAcademic Institutions and Nonprofits only