We narrowed to 858 results for: PX330
-
Plasmid#227306PurposeDonor template for mStayGold insertion into the N-terminus of the MYO1C locus. For membrane visualization. To be co-transfected with sgRNA plasmid px330-PITCh-MYO1C (Addgene #227305)DepositorInsertMYO1C Homology Arms flanking a mStayGold Tag (MYO1C Human)
UseCRISPR; Donor templateTagsExpressionMammalianMutationPromoterPromoterlessAvailable sinceNov. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMK312 (TOP2A CRISPR)
Plasmid#140654PurposeTOP2A tagging CRISPRDepositorInsertTOP2A (TOP2A Human)
UseCRISPRTagsExpressionMammalianMutationPromoterAvailable sinceNov. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
pTUB1-Spy.dCas9-CAT-U6-sgRNA(decoy)
Plasmid#171089PurposeCRISPR interference. Construct for expressing catalytically inactive Cas9 (dCas9) from Streptococcus pyogenes in Toxoplasma gondii. Suitable for generating stable cell lines.DepositorInsertsDecoy sgRNA
dCas9
Chloramphenicol acetyltransferase
UseCRISPR; Toxoplasma gondii expressionTags3X FLAG and Nuclear Localization SignalExpressionMutationD10A, H840APromoterTUB1 (Toxoplasma gondii) and U6 (Toxoplasma gondi…Available sinceOct. 4, 2021AvailabilityAcademic Institutions and Nonprofits only -
SMC2 CRISPR
Plasmid#140649PurposeSMC2 tagging CRISPRDepositorInsertSMC2 (SMC2 Human)
UseCRISPRTagsExpressionMammalianMutationPromoterAvailable sinceNov. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
qTAG-C-moxGFP-Blast-H2BC11
Plasmid#207757PurposeDonor template for moxGFP-2A-Blast insertion into the C-terminus of the H2BC11 locus for nuclei visualization. To be co-transfected with sgRNA plasmid px330-PITCh-H2BC11 Addgene #207755DepositorInsertH2BC11 Homology Arms flanking a moxGFP-Blast Cassette (H2BC11 Human)
UseCRISPR; Donor templateTagsExpressionMammalianMutationPromoterAvailable sinceNov. 16, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
qTAG-C-mNeon-Blast-TUBB4B
Plasmid#207786PurposeDonor template for mNeon-2A-Blast insertion into the C-terminus of the TUBB4B locus for tubulin visualization. To be co-transfected with sgRNA plasmid px330-PITCh-TUBB4B Addgene #207785DepositorInsertTUBB4B Homology Arms flanking a mNeon-Blast Cassette (TUBB4B Human)
UseCRISPR; Donor templateTagsExpressionMammalianMutationPromoterAvailable sinceNov. 15, 2023AvailabilityAcademic Institutions and Nonprofits only -
pgRGFP
Plasmid#82695PurposeExpresses gRNA of interest under U6 promoter (cloning by BpiI) and GFP under PGK promoter.DepositorTypeEmpty backboneUseCRISPRTagsExpressionMammalianMutationPromoterPGK, U6Available sinceNov. 11, 2016AvailabilityAcademic Institutions and Nonprofits only -
pYL214
Plasmid#171031PurposeCRISPR plasmids encodes Cas9 and a sgRNA targeting EZH2 exon 2 - intron 2 junction (sequence: GCAGACGAGCTGATGAAGTAA)DepositorInsertEZH2 (EZH2 Human)
UseCRISPRTagsExpressionMutationPromoterAvailable sinceAug. 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
qTAG-C-moxGFP-Puro-H2BC11-MMEJ
Plasmid#207760PurposeMMEJ donor template for moxGFP-2A-Puro insertion into the C-terminus of the H2BC11 locus for nuclei visualization. To be co-transfected with sgRNA plasmid px330-PITCh-H2BC11 Addgene #207755DepositorInsertH2BC11 Short Homology Arms flanking a moxGFP-Puro Cassette (H2BC11 Human)
UseCRISPR; Donor templateTagsExpressionMammalianMutationPromoterAvailable sinceNov. 15, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
qTAG-C-Solo-miRFP670nano3-H2BC11
Plasmid#227331PurposeDonor template for miRFP670nano3 insertion into the C-terminus of the H2BC11 locus. For nuclei visualization. To be co-transfected with sgRNA plasmid px330-PITCh-H2BC11 (Addgene #207755)DepositorInsertH2BC11 Homology Arms flanking a miRFP670nano3 Tag (H2BC11 Human)
UseCRISPR; Donor templateTagsExpressionMammalianMutationPromoterPromoterlessAvailable sinceNov. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
qTAG-C-Solo-mStayGold-H2BC11
Plasmid#227330PurposeDonor template for mStayGold insertion into the C-terminus of the H2BC11 locus. For nuclei visualization. To be co-transfected with sgRNA plasmid px330-PITCh-H2BC11 (Addgene #207755)DepositorInsertH2BC11 Homology Arms flanking a mStayGold Tag (H2BC11 Human)
UseCRISPR; Donor templateTagsExpressionMammalianMutationPromoterPromoterlessAvailable sinceNov. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
qTAG-N-Solo-mStayGold-PCNT
Plasmid#227285PurposeDonor template for mStayGold insertion into the N-terminus of the PCNT locus. For pericentriolar material visualization. To be co-transfected with sgRNA plasmid px330-PCNT (Addgene #227284)DepositorInsertPCNT Homology Arms flanking a mStayGold Tag (PCNT Human)
UseCRISPR; Donor templateTagsExpressionMammalianMutationPromoterPromoterlessAvailable sinceNov. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
qTAG-N-Solo-sTagRFP-TUBA1B
Plasmid#207765PurposeDonor template for sTagRFP insertion into the N-terminus of the TUBA1B locus for tubulin visualization. To be co-transfected with sgRNA plasmid px330-PITCh-TUBA1B Addgene #207763DepositorInsertTUBA1B Homology Arms flanking a sTagRFP Tag (TUBA1B Human)
UseCRISPR; Donor templateTagsExpressionMammalianMutationPromoterAvailable sinceNov. 15, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
pTij_sg_mmu_Med1_N_terminal
Plasmid#197870PurposeCRISPR/Cas9/sgRNA plasmid for cutting Med1 N terminal and building mEmerald/Halo-MED1 knock-in mESCsDepositorInsertCRSP210 (Med1 Mouse)
UseTagsExpressionMammalianMutationPromoterU6Available sinceMarch 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
pU6-(BbsI)_CBh-Cas9-T2A-mCherry
Plasmid#64324PurposeExpression vector for sgRNAs cloned into the BbsI sites and for expression of Cas9 linked to mCherry via a T2A peptideDepositorInsertsCas9
sgRNA cassette
UseCRISPRTags3xFLAG, NLS, and T2A-mCherryExpressionMammalianMutationPromoterCBh and U6Available sinceSept. 2, 2015AvailabilityAcademic Institutions and Nonprofits only -
qTAG-N-Solo-mStayGold-CETN2
Plasmid#227292PurposeDonor template for mStayGold insertion into the N-terminus of the CETN2 locus. For centriole visualization. To be co-transfected with sgRNA plasmid px330-CETN2 (Addgene #227291)DepositorInsertCETN2 Homology Arms flanking a mStayGold Tag (CETN2 Human)
UseCRISPR; Donor templateTagsExpressionMammalianMutationPromoterPromoterlessAvailable sinceNov. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
qTAG-N-Puro-mStayGold-LMNB1
Plasmid#227329PurposeDonor template for Puro-2A-mStayGold insertion into the N-terminus of the LMNB1 locus. For nuclear envelope visualization. To be co-transfected with sgRNA plasmid px330-PITCh-LMNB1 (Addgene #207770)DepositorInsertLMNB1 Homology Arms flanking a Puro-2A-mStayGold (LMNB1 Human)
UseCRISPR; Donor templateTagsExpressionMammalianMutationPromoterPromoterlessAvailable sinceNov. 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
qTAG-N-Puro-mNeon-ACTB
Plasmid#207752PurposeDonor template for Puro-2A-mNeon insertion into the N-terminus of the ACTB locus for actin visualization. To be co-transfected with sgRNA plasmid px330-PITCh-ACTB Addgene #207748DepositorInsertACTB Homology Arms flanking a Puro-mNeon Cassette (ACTB Human)
UseCRISPR; Donor templateTagsExpressionMammalianMutationPromoterAvailable sinceNov. 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
qTAG-N-Puro-moxGFP-LMNB1
Plasmid#207773PurposeDonor template for Puro-2A-moxGFP insertion into the N-terminus of the LMNB1 locus for nuclear envelope visualization. To be co-transfected with sgRNA plasmid px330-PITCh-LMNB1 Addgene #207770DepositorInsertLMNB1 Homology Arms flanking a Puro-moxGFP Cassette (LMNB1 Human)
UseCRISPR; Donor templateTagsExpressionMammalianMutationPromoterAvailable sinceNov. 15, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
qTAG-N-Puro-moxGFP-TUBA1B
Plasmid#207767PurposeDonor template for Puro-2A-moxGFP insertion into the N-terminus of the TUBA1B locus for tubulin visualization. To be co-transfected with sgRNA plasmid px330-PITCh-TUBA1B Addgene #207763DepositorInsertTUBA1B Homology Arms flanking a Puro-moxGFP Cassette (TUBA1B Human)
UseCRISPR; Donor templateTagsExpressionMammalianMutationPromoterAvailable sinceNov. 15, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits