We narrowed to 51,260 results for: des.1
-
Plasmid#208287PurposeExpresses Cry2(1-531)-mCherry-Profilin.S138EDepositorTagsmCherryExpressionMammalianMutationSer 138 (sometimes numbered 137) mutated to GluPromoterCMVAvailable SinceApril 10, 2024AvailabilityAcademic Institutions and Nonprofits only
-
OptoProfilin.S138A
Plasmid#208288PurposeExpresses Cry2(1-531)-mCherry-Profilin.S138ADepositorTagsmCherryExpressionMammalianMutationSer 138 (sometimes numbered 137) mutated to AlaPromoterCMVAvailable SinceApril 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
ATP1A1_G4_Q118R_RUNX1_+1_ATGins_Dual_pegRNA
Plasmid#173213PurposeControl vector for coselection for prime editing in human cells. Tandem expression of ATP1A1 Q118R-G4 and RUNX1 +1 ATG insertion pegRNAs from two independent U6 promoters.DepositorInsertATP1A1 G4 Q118R pegRNA + RUNX1 +1 ATG insertion pegRNA
UseCRISPR; Prime editingExpressionMammalianPromoterTandem U6 promotersAvailable SinceNov. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-h53BP1 (siRNA resistant)
Plasmid#110301PurposeMammalian expression of a EGFP-tagged full length human 53BP1 (resistant to siRNA targeting AGAACGAGGAGACGGTAATAGTGGG)DepositorInsertp53-binding protein 1 (TP53BP1 Human)
TagsEGFPExpressionMammalianMutationGAACGAGGA to GAGCGGGGCAvailable SinceMay 23, 2018AvailabilityAcademic Institutions and Nonprofits only -
pRK5-myc-Miro1 E208K/E328K
Plasmid#47894PurposeExpresses myc tagged Miro1 E208K/E328K mutantDepositorInsertMiro1 E208K/E328K (RHOT1 Human)
TagsmycExpressionMammalianMutationE208K/E328K, abolishes calcium bindingPromoterCMVAvailable SinceSept. 18, 2013AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5/FRT/TO V5 DNAJA2
Plasmid#19519DepositorAvailable SinceOct. 6, 2008AvailabilityAcademic Institutions and Nonprofits only -
pRK5-myc-Miro1 Δ593-618
Plasmid#47895PurposeExpresses myc tagged Miro1 lacking transmembrane domainDepositorInsertMiro1 Δ593-618 (RHOT1 Human)
TagsmycExpressionMammalianMutationΔ593-618, lacks transmembrane domainPromoterCMVAvailable SinceSept. 12, 2013AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5/FRT/TO HIS DNAJA2
Plasmid#19546DepositorAvailable SinceOct. 6, 2008AvailabilityAcademic Institutions and Nonprofits only -
hFLT1 delta 754-763
Plasmid#86035Purposehuman VEGFR1 with a 10 amino acid deletion in EC close to TM domainDepositorInserthuman Flt1 delta754-763 aa (FLT1 Human)
TagsFLAG, HA, and MycExpressionMammalianMutationdelta 754-763PromoterCMVAvailable SinceApril 6, 2017AvailabilityAcademic Institutions and Nonprofits only -
pJT175_GalL_A3A(Y130F)Δ186-BE3
Plasmid#145124PurposeExpressing base editor A3A(Y130F)Δ186-BE3 in yeast cellsDepositorInsertA3A(Y130F)Δ186-BE3
UseCRISPRExpressionYeastMutationA3A(Y130F; 1-186AA); spCas9(D10A)PromoterGalLAvailable SinceJuly 22, 2020AvailabilityAcademic Institutions and Nonprofits only -
LSB-hsa-miR-365a-5p
Plasmid#103483PurposeUsed to sense miRNA activity using fluorescence based tools. hsa-miR-365a-5p target in 3' UTR of of mKate. miRNA activity can be measured by the repression of mKate2 relative to EBFP2 fluorescent proteins . Plasmid is inherently unstable; please see Depositor CommentsDepositorInserthsa-miR-365a-5p target (MIR365-1 Human)
UseSynthetic BiologyExpressionMammalianPromoterEF-1aAvailable SinceNov. 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
LSB-hsa-miR-365b-3p
Plasmid#103484PurposeUsed to sense miRNA activity using fluorescence based tools. hsa-miR-365b-3p target in 3' UTR of of mKate. miRNA activity can be measured by the repression of mKate2 relative to EBFP2 fluorescent proteins . Plasmid is inherently unstable; please see Depositor CommentsDepositorInserthsa-miR-365b-3p target (MIR365-1 Human)
UseSynthetic BiologyExpressionMammalianPromoterEF-1aAvailable SinceNov. 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
TRS6E1b-luc(-732/-721) mutant 4
Plasmid#45387DepositorInsert6 copies of hPAI-1 promoter -732/-721 four point mutation (SERPINE1 Human)
UseLuciferaseTagsluciferaseExpressionMammalianMutationmutated from agacaaggttgt to acactaggatgaAvailable SinceJune 20, 2013AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-NES-YFP-CCTc
Plasmid#184328PurposeMammalian expression of the cytosolic localized YFP-CCTd(peptide of Cav1.2)DepositorInsertCCTc (CACNA1C Human)
ExpressionMammalianAvailable SinceJuly 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-NES-YFP-CCTd
Plasmid#184326PurposeMammalian expression of the cytosolic localized YFP-CCTd(peptide of Cav1.3)DepositorInsertCCTd (CACNA1D Human)
ExpressionMammalianAvailable SinceJune 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-NLS-YFP-CCTd
Plasmid#184325PurposeMammalian expression of the nuclear localized YFP-CCTd(peptide of Cav1.3)DepositorInsertCCTd (CACNA1D Human)
ExpressionMammalianAvailable SinceJune 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-NLS-YFP-CCTc
Plasmid#184327PurposeMammalian expression of the nuclear localized YFP-CCTd(peptide of Cav1.2)DepositorInsertCCTc (CACNA1C Human)
ExpressionMammalianAvailable SinceJune 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pRK5-mouse-DJ1-HA
Plasmid#29396DepositorAvailable SinceNov. 1, 2011AvailabilityAcademic Institutions and Nonprofits only -
pCMV-myc-LRH1(ES)
Plasmid#28093DepositorAvailable SinceJuly 11, 2011AvailabilityAcademic Institutions and Nonprofits only -
p3-K230-FokI_R (wt)
Plasmid#32545DepositorInsertZFN
TagsHA epitopeExpressionMammalianAvailable SinceDec. 2, 2011AvailabilityAcademic Institutions and Nonprofits only