We narrowed to 22,832 results for: Ide
-
Plasmid#214061PurposeT7 inducible LanTERN (pRSET)DepositorInsertLanTERN
Tags6x His, T7 Tag, and Xpress(tm) TagExpressionBacterialPromoterT7Available SinceFeb. 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRGEB34
Plasmid#158152PurposeConstruction of inPTG-Cas9 plasmids with a truncated 5'-UTR intron for plant genome editingDepositorTypeEmpty backboneUseCRISPRExpressionPlantAvailable SinceNov. 23, 2020AvailabilityAcademic Institutions and Nonprofits only -
pEMS1302
Plasmid#29147PurposePlasmid described in Portales-Casamar et al., PNAS, 2010 (PMID: 20807748).DepositorTypeEmpty backboneUsePleiades promoter project [sic, pleaides plieades]TagsEGFP-Cre-NLSAvailable SinceJan. 9, 2012AvailabilityAcademic Institutions and Nonprofits only -
pCN34e-yfp
Plasmid#227641PurposeNegative control plasmid encoding yfp downstream of an attenuated ktrA riboswitch. Plasmid confers ampicillin resistance to E. coli and erythromycin resistance to S. aureus.DepositorInsertyfp
ExpressionBacterialAvailable SinceDec. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSL5200 (pDonor_ISGst3)
Plasmid#210875PurposeHarbors a native ISGst3 transposon derived form Geobacillus stearothermophilus DSM 458DepositorInsertISGst3
ExpressionBacterialAvailable SinceJan. 3, 2024AvailabilityAcademic Institutions and Nonprofits only -
pHelper_Ec1_V1_ampR
Plasmid#205292PurposeHelper plasmid for ORBIT in E. coli. Expresses RecT for oligo recombineering and Bxb-1 for pInt incorporation. Has sacB for counter selection.DepositorArticleInsertCspRecT / Bxb-1
UseSynthetic BiologyAvailable SinceAug. 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
-
SNAP-23
Plasmid#186686PurposeExpresses SNAP-23 in E. ColiDepositorInsertSNAP23
TagsGST and thrombin siteExpressionBacterialPromoterT7Available SinceOct. 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
OA-1067A1
Plasmid#164847PurposeExpresses four gRNA targeting BTub gene with 3xp3-eGFP markerDepositorInsert4 gRNAs and 3xP3-eGFP
ExpressionInsectAvailable SinceJune 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
OA-1067K
Plasmid#164848PurposeExpresses four gRNA targeting Mhc gene with 3xp3-tdTomato markerDepositorInsert4 gRNAs and 3xP3-tdTomato
ExpressionInsectAvailable SinceJune 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
pSPNprM-hp
Plasmid#48120PurposeShuttle vector E. coli/B.meg.; encoding the signal peptide for protein secretion of the Bacillus megaterium protein NprM under control of the xylose inducible promoterDepositorInsertsignal peptide of NprM
UseSynthetic BiologyExpressionBacterialAvailable SinceOct. 11, 2013AvailabilityAcademic Institutions and Nonprofits only -
Ad:2CMV_A2R2-N25Ctr
Plasmid#122243PurposeExpresses a dominant negative Kash control, that lacks the actual Kash domain for LINC complex integration, in addition to fluorescently tagged (mRuby2) α-Actinin-2 on an adenoviral backboneDepositorUseAdenoviralTagsSignal Peptide (TOR1A, NM_000113.2), mNeptune2.5,…ExpressionMammalianMutationdeleted Kash domain (GGCGAGGAGGAGCGCAGCTGCGCCCTGG…PromoterCMVAvailable SinceJune 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pMRX-IBU-PFAS-FLAG
Plasmid#168226PurposeExpresses human PFAS-3xFLAG fusion in mammalian cellsDepositorAvailable SinceApril 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
Human Paralog Knockout Library (pgPEN)
Pooled Library#171172PurposeInduces knockouts of paralogous gene pairs. Plasmids express a pair of guide RNAs targeting either individual genes or a pair of paralogs.DepositorExpressionMammalianSpeciesHomo sapiens and SyntheticUseCRISPR and LentiviralAvailable SinceSept. 28, 2021AvailabilityAcademic Institutions and Nonprofits only -
pEY52
Plasmid#191055Purposeodr-1 fluorescent neural reporter driving nuclear mNeptune2.5 and mTagBFP2 expression (refer to NeuroPAL paper for expression)DepositorAvailable SinceOct. 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pKB233
Plasmid#170040PurposeEncodes PvirK-mNeonGreen reporterDepositorArticleInsertmNeonGreen
UseSynthetic BiologyExpressionBacterialPromoterPvirKAvailable SinceJuly 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
pT3TS-Dest_R1-R3
Plasmid#140878Purpose166571: Multisite gateway destination vector for in vitro transcription of RNA using T3. Accepts one pME and one p3E entry clone.DepositorInsertccdb/CAM
ExpressionMammalianAvailable SinceFeb. 22, 2021AvailabilityAcademic Institutions and Nonprofits only -
pHH0103_DNAJB1_DNAJ
Plasmid#109918PurposeProtein expression and purification of DNAJB1_DNAJDepositorInsertDNAJB1_DNAJ
ExpressionBacterialAvailable SinceOct. 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
pHH0103_DVLP1_DEP
Plasmid#109806PurposeProtein expression and purification of DVLP1_DEPDepositorInsertDVLP1_DEP
ExpressionBacterialAvailable SinceOct. 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAimR
Plasmid#98687PurposeExpresses AimR gene from the B. subtilis phage phi3T, with its native promoter, C' His-tagDepositorInsertAimR
TagsHis-tagExpressionBacterialPromoterNativeAvailable SinceSept. 6, 2017AvailabilityAcademic Institutions and Nonprofits only