We narrowed to 31,111 results for: SON
-
Plasmid#203741PurposeIntegration of OsTIR1(F74A)-3xMyc at NEUT5L locusDepositorInsertOsTIR1
UseCandida albicans integrating vectorTags3xMycMutationCodon 74 changed from Phe to Ala (F74A)PromoterACT1 (C. albicans)Available SinceAug. 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCDNA5/FRT-ChemoG-NAD
Plasmid#193821PurposeCMV overexpression of ChemoG-NAD in mammalian cell linesDepositorInsertChemoG-NAD
ExpressionMammalianMutationEGFP:A206K, T225R; HT7: L271EPromoterCMVAvailable SinceJune 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
pRRL.SIN.EF1A.JAG1-B5.GS.CAR-3G
Plasmid#194464PurposeCAR featuring: GMCSF (sig. peptide); CD8A & CD8A (hinge & TM); CD28, 4-1BB & CD3ζ (signaling domains); anti-JAG1 from J1.B5 in VH-VL order & (GGGGS)3 linker (scFv). GFP-Zeo for selection & monitoring.DepositorInsertAnti-JAG1 CAR
UseLentiviralAvailable SinceMarch 20, 2023AvailabilityAcademic Institutions and Nonprofits only -
pOmniBac zz TEV YBBR POT1
Plasmid#185444PurposeExpresses human POT1 with a zz affinity tag, YBBR labeling site, and TEV cleavage site in insect cellsDepositorAvailable SinceJune 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
pExpreS2-1-C3-10H-SIII
Plasmid#175444PurposeHiFi-compatible destination vector for secreted overexpression of 3C-cleavable, C-terminal 10His-TwinStrep tagged proteins with ExpreS2 PlatformDepositorTypeEmpty backboneTags3C-10His-TwinStrep and BiP Secretion PeptideExpressionInsectPromoterFused Actin-HSP70Available SinceMarch 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCMV-FRB-tTA-Myc
Plasmid#177911PurposeFRB-tTA-Myc tagDepositorInsertFRB-tTA
TagsMyc tagExpressionMammalianPromoterCMV promoterAvailable SinceJan. 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLenti-CMV-PtenC124S-Puro
Plasmid#135677PurposeConstitutive expression (cMV promoter) of C124S mutant Pten cDNA, Puromycin selectionDepositorAvailable SinceMarch 15, 2021AvailabilityAcademic Institutions and Nonprofits only -
pFlox c-WAPL_EYFP_FKBPF36V_Neo
Plasmid#163873PurposeAcute Depletion of WAPL-EYFPDepositorInsertWapl (Wapl Mouse)
ExpressionMammalianAvailable SinceFeb. 19, 2021AvailabilityAcademic Institutions and Nonprofits only -
p1A
Plasmid#162692PurposeExpresses H. neapolitanus CbbLS and S. elongatus Prk. Rescues CCMB1 in M9 glycerol at 10% CO2DepositorInsertH. neapolitanus CbbLS and S. elongatus Prk
TagsN terminal 6x His tag on PRKExpressionBacterialPromoterPLtet0-1 promoterAvailable SinceFeb. 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
Plas-gRNA-Z3EV
Plasmid#157659PurposeGFP gene and gRNA under Z3EV expression control (estradiol sensor), with Z3EV transcription factor to insert in the genome.DepositorInsertGFP-gRNA NatMX Z3EV
UseInsert storage (replicative in e. coli)Available SinceSept. 9, 2020AvailabilityAcademic Institutions and Nonprofits only -
pKD077
Plasmid#136473PurposeSSB-mTur2 IDL fusion expression plasmidDepositorInsertSSB-mTur2 (ssb E. coli)
TagsmTurquoise2ExpressionBacterialMutationmTurquoise2 inserted between Phe148 and Ser149PromoterT7 promoterAvailable SinceApril 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
CytERM-mAvicFP1
Plasmid#129510PurposeExpresses CytERM-mAvicFP1 in mammalian cells (for OSER assay)DepositorInsertCytERM-mAvicFP1
ExpressionMammalianPromoterCMVAvailable SinceFeb. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
CMV_Npu-saBE3.9max C-terminal
Plasmid#137180PurposeExpresses the C-terminal split-intein fragment of S. aureus BE3.9max from the CMV promoterDepositorInsertNpu-saBE3.9max_C-terminal
ExpressionMammalianPromoterCMVAvailable SinceJan. 30, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAS1-rab-3P::his-24::GCaMP6s
Plasmid#124351PurposeNuclear Localized Pan-Neuronal GCaMP6sDepositorInsertrab-3, GCaMP6s (rab-3 Nematode)
ExpressionWormAvailable SinceApril 16, 2019AvailabilityAcademic Institutions and Nonprofits only -
EF1a_SRY_P2A_Hygro_Barcode
Plasmid#120485PurposeBarcoded lentiviral vector to express SRY in mammalian cells under control of EF1a promoter. Barcoded for transcript detection in single cell RNA-seq.DepositorAvailable SinceFeb. 6, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCSD_1xNLS-SaCas9-1xNLS-3xHA-1xNLS
Plasmid#107317PurposeExpresses SaCas9 in mammalian cellsDepositorInsertSaCas9
UseCRISPRTags3xHA and 2xNLS and NLSExpressionMammalianPromoterCMV IE94Available SinceNov. 15, 2018AvailabilityAcademic Institutions and Nonprofits only -
TFF3_pCSdest
Plasmid#53888DepositorAvailable SinceMarch 27, 2018AvailabilityIndustry, Academic Institutions, and Nonprofits -
pIRESneoFLAGhAR
Plasmid#89116PurposeN-terminal FLAG-tagged full-length human androgen receptor in pIRESneo for stable expression, selection using G418 neomycinDepositorAvailable SinceApril 11, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-HIS3b
Plasmid#87402PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting HIS3b sequence AATATAGAGTGTACTAGAGG in yeast chromosome 15.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting HIS3b
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS208a
Plasmid#87383PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS208a sequence GTCCGCTAAACAAAAGATCT in yeast chromosome 2.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS208a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only