We narrowed to 932 results for: V2
-
Plasmid#201611PurposeCRISPR/Cas9-mediated gene knock-outDepositorInsertPFKM (PFKM Human)
UseCRISPR and LentiviralAvailable SinceJune 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
LENTICRISPR-ACIN1_sgRNA1
Plasmid#201588PurposeCRISPR/Cas9-mediated gene knock-outDepositorInsertACIN1 (ACIN1 Human)
UseCRISPR and LentiviralAvailable SinceJune 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
LENTICRISPR-ACIN1_sgRNA2
Plasmid#201589PurposeCRISPR/Cas9-mediated gene knock-outDepositorInsertACIN1 (ACIN1 Human)
UseCRISPR and LentiviralAvailable SinceJune 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
LENTICRISPR-HNRNPD_sgRNA2
Plasmid#201599PurposeCRISPR/Cas9-mediated gene knock-outDepositorInsertHNRNPD (HNRNPD Human)
UseCRISPR and LentiviralAvailable SinceJune 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
LENTICRISPR-LUC7L_sgRNA1
Plasmid#201600PurposeCRISPR/Cas9-mediated gene knock-outDepositorInsertLUC7L (LUC7L Human)
UseCRISPR and LentiviralAvailable SinceJune 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
LENTICRISPR-LUC7L_sgRNA2
Plasmid#201601PurposeCRISPR/Cas9-mediated gene knock-outDepositorInsertLUC7L (LUC7L Human)
UseCRISPR and LentiviralAvailable SinceJune 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
LENTICRISPR-LUC7L2_sgRNA2
Plasmid#201603PurposeCRISPR/Cas9-mediated gene knock-outDepositorInsertLUC7L2 (LUC7L2 Human)
UseCRISPR and LentiviralAvailable SinceJune 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
LENTICRISPR-PABPC1_sgRNA2
Plasmid#201609PurposeCRISPR/Cas9-mediated gene knock-outDepositorInsertPABPC1 (PABPC1 Human)
UseCRISPR and LentiviralAvailable SinceJune 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGMC00007
Plasmid#166725Purposenon targeting sgRNADepositorInsertNon-targeting guide
UseCRISPR and LentiviralExpressionMammalianAvailable SinceJune 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
Lenti-XYLT2-sgRNA
Plasmid#154862PurposeLentiviral expression of Cas9 and sgRNA targeting XYLT2DepositorAvailable SinceJuly 27, 2020AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPRv2-Snrnp40
Plasmid#134255PurposeLentivector for Snrnp40 CRISPR knockoutDepositorInsertSnrp40 (Snrnp40 Mouse)
UseCRISPR and LentiviralMutationSnrnp40 gRNA “GATAACTATGCGACGTTGAA”PromoterU6Available SinceMarch 20, 2020AvailabilityAcademic Institutions and Nonprofits only -
hCRISPRi-v2, Mitochondria, Trafficking, and Motility (h4), top 5 sgRNAs/gene
Pooled Library#83974PurposeHuman CRISPRi Pooled Library targeting Mitochondria, Trafficking, and Motility genesDepositorAvailable SinceDec. 14, 2016AvailabilityAcademic Institutions and Nonprofits only -
hCRISPRa-v2, Mitochondria, Trafficking, and Motility (h4), top 5 sgRNAs/gene
Pooled Library#83983PurposeHuman CRISPRa Pooled Library targeting Mitochondria, Trafficking, and Motility genesDepositorAvailable SinceJan. 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
mCRISPRi-v2, Mitochondria, Trafficking, and Motility (m4), top 5 sgRNAs/gene
Pooled Library#83992PurposeMouse CRISPRi Pooled Library targeting Mitochondria, Trafficking, and Motility genesDepositorAvailable SinceJan. 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
mCRISPRa-v2, Mitochondria, Trafficking, and Motility (m4), top 5 sgRNAs/gene
Pooled Library#84001PurposeMouse CRISPRa Pooled Library targeting Mitochondria, Trafficking, and Motility genesDepositorAvailable SinceJan. 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
lenti MS2-P65-HSF1_Hygro
Plasmid#61426Purposelenti vector encoding the MS2-P65-HSF1 activator helper complex with a 2A Hygro resistance marker NOTE: A version of this plasmid with improved titer is available: Addgene plasmid #89308 lentiMPH v2DepositorInsertMS2-P65-HSF1_2A_Hygro (HSF1 Human, Synthetic)
UseCRISPR and LentiviralExpressionMammalianMutationN55K in MS2PromoterEF1AAvailable SinceDec. 17, 2014AvailabilityAcademic Institutions and Nonprofits only -
pOT_2 - lenti-EFS-tNGFR-2A-puro
Plasmid#181971PurposeExpresses human truncated NGFR linked to puromycin resistance via P2A for lentiviral delivery.DepositorAvailable SinceApril 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
dCas9-CBP FL
Plasmid#179550Purposeencodes S. pyogenes dCas9 with c-terminal fusion of full length human CBP driven by EF-1alpha promoterDepositorInsertS. pyogenes dCas9 with c-terminal fusion of full length human CBP (CREBBP Human)
UseLentiviralTagsFlag TagExpressionMammalianMutationD10A; H840A in S.pyogenes Cas9PromoterEF-1alphaAvailable SinceFeb. 18, 2022AvailabilityAcademic Institutions and Nonprofits only -
pOT_1 - lenti-EFS-LTBR-2A-puro
Plasmid#181970PurposeExpresses human LTBR linked to puromycin resistance via P2A for lentiviral delivery.DepositorInsertLTBR (LTBR Human)
UseLentiviralAvailable SinceApril 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
aav-tnt-wtmrtfa-gfp
Plasmid#165037PurposeAAV-based delivery of wtMRTFA-GFP into cardiomyocytes in vivoDepositorAvailable SinceAug. 18, 2021AvailabilityAcademic Institutions and Nonprofits only