We narrowed to 16,652 results for: grn
-
Plasmid#159747PurposeUbiquitin promoter-controlled expression of 3×FLAG-NLS-zCas9-NLS. Contains gRNA scaffold for insertion of target sequence (U6-26 promoter). Selection of transgenic seeds by CFP fluoresce.DepositorArticleInsertgRNA scaffold
UseCRISPRExpressionPlantAvailable SinceOct. 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-SCP1-dSa VPR mini.-2X snRP-1 Actc1
Plasmid#99690PurposeExpresses dSa Cas9 fused to optimized combination of truncated activation domains from SCP1 promoter with dual snRP1 poly adenylation signal, and Sa sgRNA for Actc1, vector allows for strong activation of mouse Actc1, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Actc1 (gRNA sequence: GCCATTCTTGGAGCCAAGGG ) (Actc1 Synthetic, Mouse)
UseAAV and CRISPRTagsVPR miniMutationdead Cas9Available SinceSept. 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCAS
Plasmid#60847PurposeExpresses S. pyogenes Cas9 plus an HDV ribozyme-sgRNA for genome editing in yeastDepositorInsertsS. pyogenese Cas9
RNA pol III promoter (tRNA-Tyr)
hepatitis delta virus ribozyme, genomic
sgRNA
UseCRISPR and Synthetic BiologyTagsNLS/His8 and TTT 3' extension prior to sgRNAExpressionBacterial and YeastMutationL4 is UUCG tetraloop and guide targets LYP1 (CATA…Available SinceJan. 13, 2015AvailabilityAcademic Institutions and Nonprofits only -
pAAV-SCP1-dSa VPR mini.-2X snRP-1 Neurog2
Plasmid#99694PurposeExpresses dSa Cas9 fused to optimized combination of truncated activation domains from SCP1 promoter with dual snRP1 poly adenylation signal, and Sa sgRNA for Actc1, vector allows for strong activation of mouse Actc1, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Actc1 (gRNA: GGTATATAAGGGGTTTTAAG) (Actc1 Synthetic, Mouse)
UseAAV and CRISPRTagsVPR miniMutationdead Cas9Available SinceJan. 16, 2020AvailabilityAcademic Institutions and Nonprofits only -
Lenti-U6-sgMettl3
Plasmid#196263PurposeExpresses a Mettl3-targeting sgRNA driven by the U6 promoter and Cre-recombinase driven by the PGK promoterDepositorAvailable SinceMarch 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
AOI-WT-Cas9-sg-mouse Ezh2-E10-GFP
Plasmid#91879PurposeExpresses 3xFLAG-Cas9 and a gRNA targeting mouse Ezh2DepositorAvailable SinceJune 26, 2017AvailabilityAcademic Institutions and Nonprofits only -
AOI-WT-Cas9-sg-mouse Ezh2-E18-GFP
Plasmid#91880PurposeExpresses 3xFLAG-Cas9 and a gRNA targeting mouse Ezh2DepositorAvailable SinceJune 26, 2017AvailabilityAcademic Institutions and Nonprofits only -
pSpdCas9-huTET1CD-T2A-mCherry(PX458)-SghuTSDR-8
Plasmid#129036Purposetargeted DNA demethylation_human_TSDR, expression of dCas9-huTET1CD-T2A-mCherry and sgRNA8 targeting human TSDRDepositorInsertdCas9-huTET1CD, SgRNA8 (huTSDR)
TagsHA-Tag, NLS and T2A-mCherryExpressionMammalianMutationdCas9 (D10A;H840A)PromoterCbH (for dCas9-huTET1CD-T2A-EGFP) U6 (for sgRNA)Available SinceJan. 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
pSpdCas9-huTET1CD-T2A-mCherry(PX458)-SgmouseTSDR-1
Plasmid#129053Purposetargeted DNA demethylation_mouse_TSDR, expression of dCas9-huTET1CD-T2A-mCherry and sgRNA1 targeting mouse TSDRDepositorInsertdCas9-huTET1CD, SgRNA1 (mouseTSDR)
TagsHA-Tag, NLS and T2A-mCherryExpressionMammalianMutationdCas9 (D10A;H840A)PromoterCbH (for dCas9-huTET1CD-T2A-EGFP) U6 (for sgRNA)Available SinceJan. 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
pSpdCas9-huTET1CD-T2A-mCherry(PX458)-SghuTSDR-1
Plasmid#129029Purposetargeted DNA demethylation_human_TSDR, expression of dCas9-huTET1CD-T2A-mCherry and sgRNA1 targeting human TSDRDepositorInsertdCas9-huTET1CD, SgRNA1 (huTSDR)
TagsHA-Tag, NLS and T2A-mCherryExpressionMammalianMutationdCas9 (D10A;H840A)PromoterCbH (for dCas9-huTET1CD-T2A-EGFP) U6 (for sgRNA)Available SinceJan. 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
pRCA893 - pBA904 Puro-T2A-BFP KLF5 g1 CRISPRa guide guide (pRCA594 backbone) 666
Plasmid#238186PurposeLentiviral CRISPR guide vector expressing a KLF5 sgRNA with cs1 incorporated in the loop of the sgRNA constant region for 10X Direct CaptureDepositorAvailable SinceAug. 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRCA860 - pBA904 Puro-T2A-GFP EGR3 g1 CRISPRa guide guide (pRCA360 backbone)
Plasmid#238188PurposeLentiviral CRISPR guide vector expressing a EGR3 sgRNA with cs1 incorporated in the loop of the sgRNA constant region for 10X Direct CaptureDepositorAvailable SinceJuly 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRCA805 - pBA904 Puro-T2A-GFP KLF4 g1 CRISPRa guide (pRCA360 backbone) 668
Plasmid#238174PurposeLentiviral CRISPR guide vector expressing a KLF4 sgRNA with cs1 incorporated in the loop of the sgRNA constant region for 10X Direct CaptureDepositorAvailable SinceJune 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRCA803 - pBA904 Puro-T2A-GFP KLF5 g1 CRISPRa guide (pRCA360 backbone) 666
Plasmid#238172PurposeLentiviral CRISPR guide vector expressing a KLF5 sgRNA with cs1 incorporated in the loop of the sgRNA constant region for 10X Direct CaptureDepositorAvailable SinceJune 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRCA804 - pBA904 Puro-T2A-GFP KLF5 g2 CRISPRa guide (pRCA360 backbone) 665
Plasmid#238173PurposeLentiviral CRISPR guide vector expressing a KLF5 sgRNA with cs1 incorporated in the loop of the sgRNA constant region for 10X Direct CaptureDepositorAvailable SinceJune 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRCA895 - pBA904 Puro-T2A-BFP KLF4 g1 CRISPRa guide guide (pRCA594 backbone) 668
Plasmid#238187PurposeLentiviral CRISPR guide vector expressing a KLF4 sgRNA with cs1 incorporated in the loop of the sgRNA constant region for 10X Direct CaptureDepositorAvailable SinceJune 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
GG-EBNA-MIR302-3g-EEA-2g-PGK-Puro
Plasmid#201677PurposeEBNA episome plasmid for U6 promoter-driven expression of 3 gRNAs targeting miRNA302/367 (Addgene #201960) and 2 gRNAs targeting EEA-motif (Addgene #102898). Includes PGK-puro selection cassetteDepositorInsertMIR302-3g-EEA-2g-PGK-Puro
UseCRISPRExpressionMammalianPromoterU6Available SinceJune 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSpdCas9-huTET1CD-T2A-mCherry(PX458)-SgmouseTSDR-9
Plasmid#129061Purposetargeted DNA demethylation_mouse_TSDR, expression of dCas9-huTET1CD-T2A-mCherry and sgRNA9 targeting mouse TSDRDepositorInsertdCas9-huTET1CD, SgRNA9 (mouseTSDR)
TagsHA-Tag, NLS and T2A-mCherryExpressionMammalianMutationdCas9 (D10A;H840A)PromoterCbH (for dCas9-huTET1CD-T2A-EGFP) U6 (for sgRNA)Available SinceJan. 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
pSpdCas9-huTET1CD-T2A-mCherry(PX458)-SgmouseTSDR-10
Plasmid#129062Purposetargeted DNA demethylation_mouse_TSDR, expression of dCas9-huTET1CD-T2A-mCherry and sgRNA10 targeting mouse TSDRDepositorInsertdCas9-huTET1CD, SgRNA10 (mouseTSDR)
TagsHA-Tag, NLS and T2A-mCherryExpressionMammalianMutationdCas9 (D10A;H840A)PromoterCbH (for dCas9-huTET1CD-T2A-EGFP) U6 (for sgRNA)Available SinceJan. 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
pSpdCas9-huTET1CD-T2A-mCherry(PX458)-SgmouseTSDR-11
Plasmid#129063Purposetargeted DNA demethylation_mouse_TSDR, expression of dCas9-huTET1CD-T2A-mCherry and sgRNA11 targeting mouse TSDRDepositorInsertdCas9-huTET1CD, SgRNA11 (mouseTSDR)
TagsHA-Tag, NLS and T2A-mCherryExpressionMammalianMutationdCas9 (D10A;H840A)PromoterCbH (for dCas9-huTET1CD-T2A-EGFP) U6 (for sgRNA)Available SinceJan. 25, 2021AvailabilityAcademic Institutions and Nonprofits only