We narrowed to 8,021 results for: AMPH
-
Plasmid#73435PurposeCRISPR synthetic transcription factor repressor plasmid encoding dCas9, tracrRNA, and a single spacer CRISPR array encoding crRNA for orthogonal repression of T7-lac promoter variant 3A2.DepositorInsertRepressor 3A2 (orthogonal T7-lac repressor)
UseCRISPR and Synthetic BiologyExpressionBacterialPromoterConstitutive wild-type S. pyogenes promoterAvailable SinceMarch 3, 2016AvailabilityAcademic Institutions and Nonprofits only -
pdCas9-M-4A6
Plasmid#73434PurposeCRISPR synthetic transcription factor repressor plasmid encoding dCas9, tracrRNA, and a single spacer CRISPR array encoding crRNA for orthogonal repression of T7-lac promoter variant 4A6.DepositorInsertRepressor 4A6 (orthogonal T7-lac repressor)
UseCRISPR and Synthetic BiologyExpressionBacterialPromoterConstitutive wild-type S. pyogenes promoterAvailable SinceMarch 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
pdCas9-M-C4
Plasmid#73427PurposeCRISPR synthetic transcription factor repressor plasmid encoding dCas9, tracrRNA, and a single spacer CRISPR array encoding crRNA for orthogonal repression of T7-lac promoter variant C4.DepositorInsertRepressor C4 (orthogonal T7-lac repressor)
UseCRISPR and Synthetic BiologyExpressionBacterialPromoterConstitutive wild-type S. pyogenes promoterAvailable SinceApril 4, 2016AvailabilityAcademic Institutions and Nonprofits only -
shCCL20
Plasmid#65096Purposeretroviral expression of CCL20 shRNADepositorAvailable SinceJune 12, 2015AvailabilityAcademic Institutions and Nonprofits only -
pdCas9-M-3F2
Plasmid#73428PurposeCRISPR synthetic transcription factor repressor plasmid encoding dCas9, tracrRNA, and a single spacer CRISPR array encoding crRNA for orthogonal repression of T7-lac promoter variant 3F2.DepositorInsertRepressor C4 (orthogonal T7-lac repressor)
UseCRISPR and Synthetic BiologyExpressionBacterialPromoterConstitutive wild-type S. pyogenes promoterAvailable SinceApril 4, 2016AvailabilityAcademic Institutions and Nonprofits only -
MB 103C ttrSR(m13)-Bxb1_P7-sfGFP_mCherry
Plasmid#232475PurposeOptimized tetrathionate sensor with recombinase switch and fluorescent reporter (GFP), constitutive mCherryDepositorInsertsttrS
ttrR
PttrB185-269
sfGFP
AxeTxe
mCherry
Bxb1 integrase
TagsssrA degradation tagExpressionBacterialPromoterConstitutive (TTGATAGCTAGCTCAGTCCTAGGTATTGTGCTAGCā¦Available SinceNov. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
MB 45t3 thsS(t3)R-sfGFP_mCherry
Plasmid#232470PurposeOptimized thiosulfate sensor with fluorescent reporter (GFP), constitutive mCherryDepositorInsertsthsS(t3)
thsR
PphsA342
sfGFP
AxeTxe
mCherry
ExpressionBacterialMutationContains the following mutations K286Q, Q350H, Iā¦PromoterJ23100 (TTGACGGCTAGCTCAGTCCTAGGTACAGTGCTAGC), J23ā¦Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
ku70 insUP+ pXYL-G418-tNOS-pADH2-crtE-tNOS-pXYL-crtI-tNOS-pGPD-crtYB-tNOS+ku70 insD (SBE146)
Plasmid#195048Purposecassette for the deletion of ku70 and overexpression of crtE, crtI, and crtYB under different combination of promotersDepositorInsertscrtE
crtI
crtYB
ExpressionYeastPromoterpADH2, pGPD, and pXYLAvailable SinceNov. 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
ku70 insUP+ pXYL-G418-tNOS-pADH2-crtE-tNOS-pGPD-crtI-tNOS-pXYL-crtYB-tNOS+ku70 insD (SBE145)
Plasmid#195047Purposecassette for the deletion of ku70 and overexpression of crtE, crtI, and crtYB under different combination of promotersDepositorInsertscrtE
crtI
crtYB
ExpressionYeastPromoterpADH2, pGPD, and pXYLAvailable SinceNov. 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
ku70 insUP+ pXYL-G418-tNOS-pXYL-crtE-tNOS-pGPD-crtI-tNOS-pADH2-crtYB-tNOS+ku70 insD (SBE144)
Plasmid#195046Purposecassette for the deletion of ku70 and overexpression of crtE, crtI, and crtYB under different combination of promotersDepositorInsertscrtE
crtI
crtYB
ExpressionYeastPromoterpADH2, pGPD, and pXYLAvailable SinceNov. 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
pMMACE DEST CMV PE2
Plasmid#206276PurposeDEST vector for MultiSite Gateway assembly and production of recombinant baculovirus using MultiMate assembly. Encodes PE2 under the control of CMV promoter. CRE-Acceptor in MultiBac system.DepositorInsertPE2
UseCRISPR; Recombinant baculovirus production, multiā¦ExpressionMammalianAvailable SinceSept. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pdCas9-M-4F2
Plasmid#73431PurposeCRISPR synthetic transcription factor repressor plasmid encoding dCas9, tracrRNA, and a single spacer CRISPR array encoding crRNA for orthogonal repression of T7-lac promoter variant 4F2.DepositorInsertRepressor 4F2 (orthogonal T7-lac repressor)
UseCRISPR and Synthetic BiologyExpressionBacterialPromoterConstitutive wild-type S. pyogenes promoterAvailable SinceApril 4, 2016AvailabilityAcademic Institutions and Nonprofits only -
pdCas9-M-1B6
Plasmid#73430PurposeCRISPR synthetic transcription factor repressor plasmid encoding dCas9, tracrRNA, and a single spacer CRISPR array encoding crRNA for orthogonal repression of T7-lac promoter variant 1B6.DepositorInsertRepressor 1B6 (orthogonal T7-lac repressor)
UseCRISPR and Synthetic BiologyExpressionBacterialPromoterConstitutive wild-type S. pyogenes promoterAvailable SinceApril 4, 2016AvailabilityAcademic Institutions and Nonprofits only -
pdCas9-M-3H5
Plasmid#73429PurposeCRISPR synthetic transcription factor repressor plasmid encoding dCas9, tracrRNA, and a single spacer CRISPR array encoding crRNA for orthogonal repression of T7-lac promoter variant 3H5.DepositorInsertRepressor 3H5 (orthogonal T7-lac repressor)
UseCRISPR and Synthetic BiologyExpressionBacterialPromoterConstitutive wild-type S. pyogenes promoterAvailable SinceApril 4, 2016AvailabilityAcademic Institutions and Nonprofits only -
pdCas9-M-1D4
Plasmid#73433PurposeCRISPR synthetic transcription factor repressor plasmid encoding dCas9, tracrRNA, and a single spacer CRISPR array encoding crRNA for orthogonal repression of T7-lac promoter variant 1D4.DepositorInsertRepressor 1D4 (orthogonal T7-lac repressor)
UseCRISPR and Synthetic BiologyExpressionBacterialPromoterConstitutive wild-type S. pyogenes promoterAvailable SinceMarch 7, 2016AvailabilityAcademic Institutions and Nonprofits only -
pdCas9-M-1E4
Plasmid#73436PurposeCRISPR synthetic transcription factor repressor plasmid encoding dCas9, tracrRNA, and a single spacer CRISPR array encoding crRNA for orthogonal repression of T7-lac promoter variant 1E4.DepositorInsertRepressor 1E4 (orthogonal T7-lac repressor)
UseCRISPR and Synthetic BiologyExpressionBacterialPromoterConstitutive wild-type S. pyogenes promoterAvailable SinceMarch 3, 2016AvailabilityAcademic Institutions and Nonprofits only -
pdCas9-M-5F5
Plasmid#73432PurposeCRISPR synthetic transcription factor repressor plasmid encoding dCas9, tracrRNA, and a single spacer CRISPR array encoding crRNA for orthogonal repression of T7-lac promoter variant 5F5.DepositorInsertRepressor 5F5 (orthogonal T7-lac repressor)
UseCRISPR and Synthetic BiologyExpressionBacterialPromoterConstitutive wild-type S. pyogenes promoterAvailable SinceMarch 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
pGL4.23-GW
Plasmid#60323PurposeThis is a modified version of the pGL4.23 vector from Promega, containing a Gateway cassette upstream of the minimal promoter. This vector can be used for for Gateway cloning of candidate enhancer elements. As negative control, use pGL4.23 without the gateway cassette (available from Promega).DepositorTypeEmpty backboneUseLuciferaseTagsLuciferaseExpressionMammalianAvailable SinceDec. 2, 2014AvailabilityAcademic Institutions and Nonprofits only -
pLX304-GW-DCK*-IRES-GFP
Plasmid#176291PurposeGateway vector for use in generating POI-DCK* fusion reporterDepositorInsertMutant Deoxycytidine Kinase (DCK*, S74E R104M D133A) (DCK Human)
UseLentiviralTagsV5ExpressionMammalianMutationS74E R104M D133APromoterCMVAvailable SinceMarch 23, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLX304-DCK*-GW-IRES-GFP
Plasmid#176289PurposeGateway vector for use in generating DCK*-POI fusion reporterDepositorInsertMutant Deoxycytidine Kinase (DCK*, S74E R104M D133A) (DCK Human)
UseLentiviralTagsV5ExpressionMammalianMutationS74E R104M D133APromoterCMVAvailable SinceMarch 23, 2023AvailabilityAcademic Institutions and Nonprofits only