We narrowed to 11,091 results for: phen
-
Plasmid#221959PurposeExpresses mitochondrial cytosine base editor arm in mammalian cellsDepositorInsertCOX8A MTS-3xFLAG-TALE NT-alphaN-ATP6 TALE G2 repeats-TALE CTD-DddAtox 1397N-UGI-ATP5B 3'UTR
UseCRISPRTags3xFLAGExpressionMammalianMutationTALE: Q231R, W232G, S233A, See depositor commentsPromoterCMVAvailable SinceSept. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
ATP6 alphaDdCBE T1
Plasmid#221960PurposeExpresses mitochondrial cytosine base editor arm in mammalian cellsDepositorInsertCOX8A MTS-3xFLAG-TALE NT-alphaN-ATP6 TALE T1 repeats-TALE CTD-DddAtox 1397C-UGI-ATP5B 3'UTR
UseCRISPRTags3xFLAGExpressionMammalianMutationTALE: Q231R, W232G, S233APromoterCMVAvailable SinceSept. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
ATP6 alphaDdCBE T2
Plasmid#221961PurposeExpresses mitochondrial cytosine base editor arm in mammalian cellsDepositorInsertCOX8A MTS-3xFLAG-TALE NT-alphaN-ATP6 TALE T2 repeats-TALE CTD-DddAtox 1397N-UGI-ATP5B 3'UTR
UseCRISPRTags3xFLAGExpressionMammalianMutationTALE: Q231R, W232G, S233APromoterCMVAvailable SinceSept. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLPP4
Plasmid#209966PurposeContains Level 0 Part: constitutive Promoter (P40) for the construction of Level 1 plasmidsDepositorInsertPromoter (P40)
ExpressionBacterialAvailable SinceSept. 13, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
pLP-EV
Plasmid#209973PurposeContains Level 0 Part: mock coding sequence (EV) for the construction of Level 1 plasmidsDepositorInsertCDS (mock)
ExpressionBacterialAvailable SinceSept. 13, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
pLPC53
Plasmid#209962PurposeContains Level 0 Part: 5' Connector (5C1CSN with double terminator Tcat+sai) for the construction of Level 1 plasmidsDepositorInsert5' Connector (5C1CSN_Tcat+sai)
ExpressionBacterialAvailable SinceSept. 13, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
PGK Promoter (MTK 2) (pAN2822)
Plasmid#194224PurposeMammalian Toolkit part 2 encoding the PGK promoterDepositorInsertPGK Promoter
UseSynthetic BiologyPromoterPGKAvailable SinceSept. 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
EF1a Promoter (MTK 2) (pAN2824)
Plasmid#194225PurposeMammalian Toolkit part 2 containing the EF1a promoterDepositorInsertEF1a Promoter
UseSynthetic BiologyPromoterEF1aAvailable SinceSept. 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
LCB1_v1.3 (MTK 3a) (pZYW044)
Plasmid#194227PurposeMammalian Toolkit part 3a encoding the synthetic Spike binder LCB1DepositorInsertLCB1_v1.3
UseSynthetic BiologyPromoterNoneAvailable SinceSept. 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
LCB3_v1.2 (MTK 3a) (pZYW045)
Plasmid#194228PurposeMammalian Toolkit part 3a encoding the synthetic Spike binder LCB3DepositorInsertLCB3_v1.2
UseSynthetic BiologyPromoterNoneAvailable SinceSept. 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
WPRE (MTK 4b) (pAN2410)
Plasmid#194235PurposeMammalian Toolkit Part 4b encoding the WPRE for use with lentiviral backbonesDepositorInsertWPRE terminator
UseSynthetic BiologyPromoterNoneAvailable SinceSept. 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
pHBJT006
Plasmid#225157PurposeLow copy cloning vector for integration of C-terminal FLAG epitope tag (ChlR). SmaI restriction site immediately upstream of the FLAG epitope. FLAG epitope in opposite orientation of lac promoter.DepositorTypeEmpty backboneUseSynthetic BiologyTagsFLAG epitope tag (35 bp)ExpressionBacterialAvailable SinceSept. 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
pHBJT005
Plasmid#225156PurposeLow copy cloning vector for integration of C-terminal FLAG epitope tag (ChlR). SmaI restriction site immediately upstream of the FLAG epitope. FLAG epitope in same orientation as lac promoter.DepositorTypeEmpty backboneUseSynthetic BiologyTagsFLAG epitope tag (35 bp)ExpressionBacterialAvailable SinceSept. 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
Tol2-U6.3-sgRNA-non-targeting-control -GFP
Plasmid#221844PurposeTol2 transposon expresses control non-targeting sgRNA from chick U6.3 promoter expresses GFP reporter from GAGC promoterDepositorInsertsEGFP
non-targeting control sgRNA- GCACTGCTACGATCTACACC
UseCRISPR; Tol2 transposon optimised for chick expre…ExpressionMammalianPromoterGACG and U6.3 chickAvailable SinceJuly 31, 2024AvailabilityAcademic Institutions and Nonprofits only -
GB4666
Plasmid#215271PurposepUPD2 for the Arabidopsis thaliana ABA-responsive MAPKKK18 promoter.DepositorInsertpromMAPKKK18
UseSynthetic BiologyMutationBsaI and BsmBI sites removedAvailable SinceJuly 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
GB3474
Plasmid#215370PurposeCDS of CPH from N. nambi codon optimized for N.benthamiana. This gene is the final step and recycling of the bioluminiscente pathwayDepositorInsertCPH
UseSynthetic BiologyMutationBsaI and BsmBI sites removedAvailable SinceJune 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
GB3473
Plasmid#215246PurposeCDS of Luz gene from N. nambi codon optimized for N.benthamiana. This gene generate the luminiscence of the bioluminiscente pathwayDepositorInsertLuz
UseSynthetic BiologyMutationBsaI and BsmBI sites removedAvailable SinceJune 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
GB3472
Plasmid#215245PurposeCDS of H3H from N. nambi codon optimized for N.benthamiana. This gene is the second step of the bioluminiscente pathwayDepositorInsertH3H
UseSynthetic BiologyMutationBsaI and BsmBI sites removedAvailable SinceJune 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDSK519-cspB
Plasmid#207162PurposeExpresses codon-optimized cspB from Clavibacter michiganensis in a broad host range vectorDepositorInsertcspB
TagsHAExpressionBacterialPromoternptIIAvailable SinceJune 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
pPB-W-ccdB-Z
Plasmid#218893Purposegolden gate cloningDepositorTypeEmpty backboneUseSynthetic BiologyAvailable SinceMay 29, 2024AvailabilityAcademic Institutions and Nonprofits only