We narrowed to 1,107 results for: gibson assembly
-
Plasmid#80610PurposepLIB - Library vector (biGBac system for expression of protein complexes in insect cells)DepositorTypeEmpty backboneExpressionInsectPromoterpolyhedrinAvailable SinceOct. 20, 2016AvailabilityAcademic Institutions and Nonprofits only
-
pWM_12x601_25bpLinker
Plasmid#157788PurposeEcoRV digestion produces 12x601 chromatin assembly construct with 25 bp linker lengths in addition to carrier DNA that prevents overassembly of nucleosomesDepositorInsert12x601_25bp linker
ExpressionBacterialAvailable SinceMarch 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
pENTR_HA-spGFP11
Plasmid#240224PurposeGateway entry clone for cloning in insert sequences by gibson assembly to create a C-terminal HA-spGFP11 tag. No ATG start codon.DepositorTypeEmpty backboneUseGateway shuttle vectorAvailable SinceJuly 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
p006-GFP-pBAD
Plasmid#108315PurposeGFP from jellyfish Aquorea sp. under pBAD promoter with AraC repressor; kanamycin resistant.DepositorInsertGFP under control of arabinose-inducible promoter pBAD
ExpressionBacterialPromoterpBADAvailable SinceAug. 17, 2018AvailabilityAcademic Institutions and Nonprofits only -
TOPO Cre-2A-GFP
Plasmid#68450PurposeTOPO construct expressing Cre-2A-GFP for generation of GMAP-compatible geneDepositorInsertCre-2A-GFP
UseGmapExpressionBacterialPromoterPlacAvailable SinceFeb. 22, 2016AvailabilityAcademic Institutions and Nonprofits only -
pBIG2ab
Plasmid#80616PurposepBIG2ab - Step2 vector ab (biGBac system for expression of protein complexes in insect cells)DepositorTypeEmpty backboneExpressionInsectAvailable SinceOct. 20, 2016AvailabilityAcademic Institutions and Nonprofits only -
pLV_3xFLAG-ATP6V0A3-mScarlet
Plasmid#228867PurposeStable expression of V-ATPase subunit ATP6V0A3 with N-terminal 3xFLAG and C-terminal mScarletDepositorAvailable SinceNov. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLV_3XHA-ATP6V1B2-mNeonGreen
Plasmid#228865PurposeStable expression of V-ATPase subunit ATP6V1B2 with N-terminal 3xHA and C-terminal mNeonGreenDepositorAvailable SinceNov. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
pBIG1b
Plasmid#80612PurposepBIG1b - Step1 vector b (biGBac system for expression of protein complexes in insect cells)DepositorTypeEmpty backboneExpressionInsectAvailable SinceOct. 20, 2016AvailabilityAcademic Institutions and Nonprofits only -
STAGR_gRNAScaffold_hU6
Plasmid#102840PurposeCan be used as PCR template for a STAgR reactionDepositorInsertgRNAScaffold_hU6promoter
PromoterhU6Available SinceFeb. 6, 2019AvailabilityAcademic Institutions and Nonprofits only -
pUCC001
Plasmid#124451PurposeMulti-species CRISPR/Cas9 coexpression system, optimized for Golden Gate cloning of gRNA targetsDepositorInsertHH-BsaI
ExpressionYeastMutationgRNA expression cassette from pUDP002 modified to…PromoterTDH3 promoter from S.cerevisiae (already present …Available SinceSept. 26, 2019AvailabilityAcademic Institutions and Nonprofits only -
The Xenorhabdus griffiniae part library
Plasmid Kit#1000000274PurposeUse this parts library for Golden Gate and Gibson assemblies to express DNA parts in the bacterium Xenorhabdus griffiniae.DepositorApplicationCloning and Synthetic BiologyVector TypeBacterial ExpressionCloning TypeGolden GateAvailable SinceFeb. 13, 2026AvailabilityAcademic Institutions and Nonprofits only -
TRE-mClover3-TDP-43ΔNLS
Plasmid#214917Purposeinducible expression of TDP-43 harboring mutant NLS and N-terminal mClover3. Expression yields cytosolic TDP-43 that forms peinuclear punctaDepositorInsertTDP-43ΔNLS (TARDBP Human)
UseLentiviralTagsmClover3Mutationmutant NLS GCAGCAGCAATGGATGAGACAGATGCTTCATCAGCAGT…Available SinceMarch 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
pWM_12x601_15bpLinker
Plasmid#157786PurposeEcoRV digestion produces 12x601 chromatin assembly construct with 15 bp linker lengths in addition to carrier DNA that prevents overassembly of nucleosomesDepositorInsert12x601_15bp linker
ExpressionBacterialAvailable SinceMarch 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
pWM_12x601_30bpLinker
Plasmid#157789PurposeEcoRV digestion produces 12x601 chromatin assembly construct with 30 bp linker lengths in addition to carrier DNA that prevents overassembly of nucleosomesDepositorInsert12x601_30bp linker
ExpressionBacterialAvailable SinceMarch 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
SspBmicro-mCh-p60
Plasmid#190168PurposeExpresses SspBmicro-mCh-p60, a recruitable katanin for microtubule severing, in mammalian cells.DepositorInsertSspBmicro-mCherry-p60
TagsSspBmicro-mCherryExpressionMammalianAvailable SinceDec. 2, 2022AvailabilityAcademic Institutions and Nonprofits only -
pWM_12x601_45bpLinker
Plasmid#157791PurposeEcoRV digestion produces 12x601 chromatin assembly construct with 45 bp linker lengths in addition to carrier DNA that prevents overassembly of nucleosomesDepositorInsert12x601_45bp linker
ExpressionBacterialAvailable SinceMarch 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
SpySwitch
Plasmid#184225PurposeExpresses SpySwitch in the bacterial cytoplasm. SpySwitch binds SpyTag-, SpyTag002- or SpyTag003-fusions non-covalently for affinity purification, allowing gentle pH or temperature release.DepositorInsertSpySwitch
TagsHis6ExpressionBacterialMutationE77A mutation prevents isopeptide bond formation,…PromoterT7Available SinceJune 29, 2022AvailabilityAcademic Institutions and Nonprofits only -
EB3N-VVDfast-mCl3-iLID
Plasmid#190165PurposeExpresses EB3N-VVDfast-mCl3-iLID, a microtubule anchor used for optogenetic recruitment of SspB-mCh-p60, in mammalian cells.DepositorInsertEB3N-VVDfast-mClover3-iLID (MAPRE3 Synthetic, Human)
Tags-VVDfast-mClover3-iLIDExpressionMammalianMutation1-189 aa from EB3Available SinceOct. 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Syn-ERT2-iCre-ERT2
Plasmid#178059PurposeConditionally active form of Cre recombinase (activated in response to tamoxifen) under Syn promoter.DepositorInsertERT2-iCre-ERT2
UseAAVExpressionMammalianPromoterHuman synapsin 1 (Syn) promoterAvailable SinceOct. 9, 2022AvailabilityAcademic Institutions and Nonprofits only