We narrowed to 4,533 results for: Gaa
-
-
COL4A3BP gRNA (BRDN0001147254)
Plasmid#77850Purpose3rd generation lentiviral gRNA plasmid targeting human COL4A3BPDepositorInsertCOL4A3BP
UseCRISPR and LentiviralExpressionMammalianPromoterhU6Available SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
PANK1 gRNA (BRDN0001146939)
Plasmid#76556Purpose3rd generation lentiviral gRNA plasmid targeting human PANK1DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
TESK2 gRNA (BRDN0001146547)
Plasmid#76432Purpose3rd generation lentiviral gRNA plasmid targeting human TESK2DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
N4BP2 gRNA (BRDN0001146240)
Plasmid#76336Purpose3rd generation lentiviral gRNA plasmid targeting human N4BP2DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
NEK5 gRNA (BRDN0001146851)
Plasmid#76117Purpose3rd generation lentiviral gRNA plasmid targeting human NEK5DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
SNX16 gRNA (BRDN0001146480)
Plasmid#75835Purpose3rd generation lentiviral gRNA plasmid targeting human SNX16DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
PAK7 gRNA (BRDN0001149524)
Plasmid#75715Purpose3rd generation lentiviral gRNA plasmid targeting human PAK7DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
NEK10 gRNA (BRDN0001162522)
Plasmid#75635Purpose3rd generation lentiviral gRNA plasmid targeting human NEK10DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
MYO3B gRNA (BRDN0001145051)
Plasmid#75568Purpose3rd generation lentiviral gRNA plasmid targeting human MYO3BDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pGS1412
Plasmid#63787PurposeVector to create a cassette for homologous recombination in S. cerevisiae; adds a C-terminal eCitrine Strep-tag II followed by URA3 selection markerDepositorInserteCitrine-Strep-tag II followed by URA3 selection marker
UseE. coli cloning vectorTagseCitrine-Strep-tag IIPromoternoneAvailable SinceApril 17, 2015AvailabilityAcademic Institutions and Nonprofits only -
pENTR-TER+-shDIXDC1-Hu-16
Plasmid#61237PurposeEntry clone encoding shRNA to human DIXDC1DepositorInsertDIXDC1 (DIXDC1 Human)
UseEntr cloneAvailable SinceMarch 20, 2015AvailabilityAcademic Institutions and Nonprofits only -
-
pLKO.1-puro-cfSec15A_2
Plasmid#26715DepositorInsertDog Sec15A RNAi (EXOC6 C. familiaris (dog RNAi))
UseLentiviral and RNAiExpressionMammalianMutationDog Sec15A RNAi.Available SinceDec. 15, 2010AvailabilityAcademic Institutions and Nonprofits only -
pLENTICRISPR-NDUFB5-sgRNA1
Plasmid#165939PurposeCRISPR-mediated gene perturbation (knock-out) of NDUFB5DepositorArticleAvailabilityAcademic Institutions and Nonprofits only -
pLENTICRISPR-PGAM1-sgRNA2
Plasmid#165944PurposeCRISPR-mediated gene perturbation (knock-out) of PGAM1DepositorArticleAvailabilityAcademic Institutions and Nonprofits only -
pLV-PGK-DIO-mCherry-TLR4miR-TLR2miR
Plasmid#137733PurposeLentivirus vector for TLR2/4 miR in a Cre-dependent mannerDepositorInsertTKR2/4 microRNA
UseLentiviralTagsmChherryExpressionMammalianAvailable SinceMarch 11, 2020AvailabilityAcademic Institutions and Nonprofits only -
plentiCRISPR-v2 Puro EIF2AK4/GCN2_sgRNA
Plasmid#218528PurposesgRNA targeting human EIF2AK4/GCN2DepositorInsertEIF2AK4 (EIF2AK4 Human)
UseCRISPR and LentiviralAvailable SinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
Lenti-EFS-BirAopt-GSQ-RNF4wt-P2A-BLAST
Plasmid#208046PurposeEnables constitutive expression of N-terminal BirAopt-fused RNF4wt; to perform bioE3; selection with blasticidinDepositorAvailable SinceNov. 29, 2023AvailabilityAcademic Institutions and Nonprofits only -
Arf1-GFP
Plasmid#39554DepositorAvailable SinceSept. 10, 2012AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-h53BP1 (siRNA resistant)
Plasmid#110301PurposeMammalian expression of a EGFP-tagged full length human 53BP1 (resistant to siRNA targeting AGAACGAGGAGACGGTAATAGTGGG)DepositorInsertp53-binding protein 1 (TP53BP1 Human)
TagsEGFPExpressionMammalianMutationGAACGAGGA to GAGCGGGGCAvailable SinceMay 23, 2018AvailabilityAcademic Institutions and Nonprofits only -
pBAD-GINKO2
Plasmid#177116PurposeBacterial expression of genetically encoded green fluorescent potassium ion indicator GINKO2DepositorInsertGINKO2
Tags6-His Tag, T7 tag (gene 10 leader), and Xpress™ t…ExpressionBacterialAvailable SinceJan. 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLenti-EF1a-SPdCas9-DNMT3B-2A-Blast
Plasmid#71217PurposedCas9 fused to human DNMT3B catalytic domainDepositorInsertdSpCas9-DNMT3B catalytic domain
UseCRISPR and LentiviralExpressionMammalianAvailable SinceJune 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pFC902
Plasmid#106904PurposeThe vector has a U3 promoter and terminator controlled gene encoding a transcript containing the sgRNA flanked by a tRNA-Gly repeat; and a gene encoding cas9 controlled by Ptef1 and Ttef1DepositorInsertscas9
pyrG
U3 promoter and terminator controlled gene encoding a transcript containing the sgRNA flanked by a tRNA gly repeat
UseCRISPR; Fungal expressionTagsSV40 NLSExpressionBacterialAvailable SinceMay 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
pEND-351_Cacnes_dCas9_CRISPRi
Plasmid#225617PurposeCutibacterium acnes replicative plasmid with dCas9 for CRISPRi. pBRESP36A-based vector optimized for reduced size and modular assembly, harbouring a medium-copy pBR322 E. coli ori (no ROP)DepositorInsertdCas9
UseCRISPR and Synthetic BiologyTags6xHisExpressionBacterialMutationCodon optimized for Cutibacterium acnesAvailable SinceFeb. 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1 shRUNX1 puro
Plasmid#45816DepositorAvailable SinceJune 17, 2013AvailabilityAcademic Institutions and Nonprofits only -
Lenti-EFS-FLTID-GSQ-RBXN-P2A-BLAST
Plasmid#208041PurposeEnables constitutive expression of TurboID alone; RBXN represents a EcoR1-BsiW1-Xba1-Not1 polylinker; selection with blasticidinDepositorInsertTurboID
UseLentiviralPromoterEFSAvailable SinceOct. 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shGFP
Plasmid#110318PurposeControl (Target CAAGCTGACCCTGAAGTTCAT), silence GFP and express monomeric Kusabira-Orange2DepositorInsertGFP
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceAug. 13, 2018AvailabilityAcademic Institutions and Nonprofits only -
SPHK2 gRNA (BRDN0001146242)
Plasmid#77095Purpose3rd generation lentiviral gRNA plasmid targeting human SPHK2DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pLKO-Tet-On shYap1-1
Plasmid#193669PurposeTet inducible knockdown of Yap1DepositorInsertYap1 (Yap1 Mouse)
UseLentiviralAvailable SinceDec. 20, 2022AvailabilityAcademic Institutions and Nonprofits only
