We narrowed to 1,070 results for: Superfolder GFP
-
Plasmid#180330Purposemammalian expression of human SEPT9_i1 NCmut2 fused to monomeric superfolder GFPDepositorInsertSEPTIN9_v1 (SEPTIN9 Human)
TagsmsfGFPExpressionMammalianMutationSEPT9_i1 I281D, M288DPromoterCMVAvailable SinceMarch 29, 2022AvailabilityAcademic Institutions and Nonprofits only -
pnEA-vH_His-TEV-DSep1-msfGFP
Plasmid#174494Purposebacterial expression of Drosophila Sep1 fused to monomeric superfolder GFPDepositorAvailable SinceNov. 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
Reckleen_3plus_sgRNA_ptet_pos5a1
Plasmid#233462PurposeLevel 1 part, Ptet sfgfp dropout sgRNA for position 5a1, for building RECKLEEN plasmid with multiple sgRNAsDepositorInsertLevel 1 part, Ptet sfgfp dropout sgRNA for position 5a1, ColE1 ori, and KanR.
UseCRISPRAvailable SinceApril 24, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
Reckleen_3plus_sgRNA_ptet_pos5a2
Plasmid#233463PurposeLevel 1 part, Ptet sfgfp dropout sgRNA for position 5a2, for building RECKLEEN plasmid with multiple sgRNAsDepositorInsertLevel 1 part, Ptet sfgfp dropout sgRNA for position 5a2, ColE1 ori, and KanR.
UseCRISPRAvailable SinceApril 24, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
Reckleen_3plus_sgRNA_ptet_pos5b1
Plasmid#233465PurposeLevel 1 part, Ptet sfgfp dropout sgRNA for position 5b1, for building RECKLEEN plasmid with multiple sgRNAsDepositorInsertLevel 1 part, Ptet sfgfp dropout sgRNA for position 5b1, ColE1 ori, and KanR.
UseCRISPRAvailable SinceApril 24, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
Reckleen_3plus_sgRNA_ptet_pos5b2
Plasmid#233466PurposeLevel 1 part, Ptet sfgfp dropout sgRNA for position 5b2, for building RECKLEEN plasmid with multiple sgRNAsDepositorInsertLevel 1 part, Ptet sfgfp dropout sgRNA for position 5b2, ColE1 ori, and KanR.
UseCRISPRAvailable SinceApril 24, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
pTone-gata2aECE-nsGFP
Plasmid#132975Purposegata2a endothelial enhancer (x6) and basal promoter driving nuclear-localized sfGFP in pTol1 backboneDepositorInsertsnuclear localized sfGFP
gata2a endothelial enhancer (x6) with a carp b-actin basal promoter
UseUnspecified; Transposon-mediatedTags6x myc and SV40 NLSAvailable SinceDec. 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
pUS252
Plasmid#127674PurposeExpresses fuGFP constitutively in E.coli cells. Designed to act as modular template for cutting out or amplifying fuGFP to place in other plasmid backbonesDepositorInsertFree Use GFP (fuGFP)
ExpressionBacterialPromoterlacAvailable SinceJune 24, 2019AvailabilityIndustry, Academic Institutions, and Nonprofits -
pCMV_SEPT2-msfGFP
Plasmid#180318Purposemammalian expression of human SEPT2 fused to monomeric superfolder GFPDepositorAvailable SinceDec. 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
pVHed07
Plasmid#82350PurposeBxb1/TP901 temporal logic gate with mKate2 and sfGFP in Phi80 chromosomal integration plasmidDepositorInsertsmKate2 RFP
Superfolder GFP
Temporal logic gate with TP901 and Bxb1 attachment sites
UseSynthetic BiologyExpressionBacterialAvailable SinceJan. 20, 2017AvailabilityAcademic Institutions and Nonprofits only -
MB 101A ttrSR(m13)-sfGFP_mCherry
Plasmid#232474PurposeOptimized tetrathionate sensor with fluorescent reporter (GFP), constitutive mCherryDepositorInsertsttrS
ttrR
PttrB185-269
sfGFP
AxeTxe
mCherry
ExpressionBacterialPromoterConstitutive (TTGATAGCTAGCTCAGTCCTAGGTATTGTGCTAGC…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCMVtrunc Affimer6-msfGFPΔN12
Plasmid#231550PurposeMammalian expression of actin-binding Affimer6 fused to N-terminally truncated monomeric superfolder GFP, for actin filament organization measurements using fluorescence polarization microscopyDepositorInsertAffimer6
TagsmsfGFPExpressionMammalianPromoterCMVtruncAvailable SinceJan. 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCMVtrunc msfGFPΔC9-LifeactΔN2
Plasmid#231556PurposeMammalian expression of N-terminally truncated Lifeact fused to C-terminally truncated monomeric superfolder GFP for actin filament organization measurements using fluorescence polarization microscopyDepositorAvailable SinceJan. 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
MB 45t3 thsS(t3)R-sfGFP_mCherry
Plasmid#232470PurposeOptimized thiosulfate sensor with fluorescent reporter (GFP), constitutive mCherryDepositorInsertsthsS(t3)
thsR
PphsA342
sfGFP
AxeTxe
mCherry
ExpressionBacterialMutationContains the following mutations K286Q, Q350H, I…PromoterJ23100 (TTGACGGCTAGCTCAGTCCTAGGTACAGTGCTAGC), J23…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
PB533_2E12LI-sfGFP
Plasmid#167527PurposeH3K27me3-mintbody expression vector for mammalian cellsDepositorInsert2E12LI-scFv
TagssfGFPExpressionMammalianAvailable SinceApril 2, 2021AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-sACE2(WT)-sfGFP
Plasmid#145171PurposeMammalian expression plasmid for soluble ACE2-super folder GFP fusionDepositorInsertAngiotensin-converting enzyme 2 (ACE2 Human)
TagsLinker GSGGSGSGG and superfolder GFPExpressionMammalianMutationExtracellular, soluble protease domain (a.a. M1-D…PromoterCMVAvailable SinceApril 15, 2020AvailabilityAcademic Institutions and Nonprofits only -
pScarlessHD-sfGFP-DsRed
Plasmid#80811PurposeVector containing a cassette for scarless insertion of sfGFP and marked by the visible marker 3xP3-DsRed flanked by piggyBac termini.DepositorInsertsfGFP-piggyBac-DsRed
UseUnspecifiedTagssfGFPAvailable SinceNov. 28, 2016AvailabilityAcademic Institutions and Nonprofits only -
pYN2_1
Plasmid#184757PurposePlasmid for genome editing by CRISPR/Cas9DepositorInsertsCas9
sgRNA scaffold where sfGFP is replaced with gRNA protospacer of interest, which will be proceeded by the HDV Ribozyme
UseSynthetic BiologyTags2xNLSExpressionBacterial and YeastPromoterPGK1 and tRNA-Phe-HDV RibozymeAvailable SinceFeb. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pHAGE-EFS-PCP-GFPnls
Plasmid#121938PurposeCRISPR-Sirius plasmidDepositorInsertPCP-GFPnls
UseLentiviralTagssfGFPExpressionMammalianPromoterEFSAvailable SinceFeb. 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
PB533-42B3mutAC2-sfGFP
Plasmid#186777PurposeRNAP2 Ser2ph-mintbody [42B3(R78K/A80T/M95V)-scFv] expression vector for mammalian cellsDepositorInsert42B3mutAC2-scFv
TagssfGFPExpressionMammalianAvailable SinceAug. 9, 2022AvailabilityAcademic Institutions and Nonprofits only