We narrowed to 72,039 results for: nin
-
Plasmid#40765PurposeTo evaluate the efficacy of silencing and the extent of cooperativity directed by a small silencing RNA bound at one or multiple sites on an mRNADepositorInsertCXCR4 small RNA perfect to bulged target site
UseLuciferaseTagsluciferaseMutationmutated from TAG to CTC at nt 387–389 of the Reni…PromoterTKAvailable SinceDec. 18, 2013AvailabilityAcademic Institutions and Nonprofits only -
pWPT-ACC/ACC/ACC/ACC-mEGFP-IRES-mCherry
Plasmid#49227PurposeLentiviral expression vector. Contains an altered Kozak sequence and/or upstream open reading frames to modulate expression at the level of translation.DepositorInsertsmEGFP
mCherry
UseLentiviral and Synthetic BiologyTagsSfuI site to create C-terminal fusionsExpressionMammalianPromoterEF1-shortAvailable SinceDec. 5, 2013AvailabilityAcademic Institutions and Nonprofits only -
mutpRL-TK 1x perfect to seed siRNA
Plasmid#40766PurposeTo evaluate the efficacy of silencing and the extent of cooperativity directed by a small silencing RNA bound at one or multiple sites on an mRNADepositorInsertCXCR4 small RNA perfect to seed target site
UseLuciferaseTagsluciferaseMutationmutated from TAG to CTC at nt 387–389 of the Reni…PromoterTKAvailable SinceSept. 26, 2013AvailabilityAcademic Institutions and Nonprofits only -
mutpRL-TK 1x perfect to seed plus 13-16 siRNA
Plasmid#40767PurposeTo evaluate the efficacy of silencing and the extent of cooperativity directed by a small silencing RNA bound at one or multiple sites on an mRNADepositorInsertCXCR4 small RNA perfect to seed plus 13-16 target site
UseLuciferaseTagsluciferaseMutationmutated from TAG to CTC at nt 387–389 of the Reni…PromoterTKAvailable SinceSept. 26, 2013AvailabilityAcademic Institutions and Nonprofits only -
pGEX-2TK-WW-CR-W3083F
Plasmid#18076DepositorInsertDystrophin (DMD Human)
TagsGSTExpressionBacterialMutationSecond conserved Tryptophan (W) of the WW domain …Available SinceMay 29, 2008AvailabilityAcademic Institutions and Nonprofits only -
pGEX-2TK-WW-CR-d-ZZ-W3083F
Plasmid#18078DepositorInsertDystrophin (DMD Human)
TagsGSTExpressionBacterialMutationSecond conserved Tryptophan (W) of the WW domain …Available SinceMay 29, 2008AvailabilityAcademic Institutions and Nonprofits only -
pM-ErbB4-delta-kinase-PY1 mutant
Plasmid#17801DepositorInsertErbB4 (ERBB4 Human)
TagsGAL4-BDExpressionMammalianMutationCarboxy-terminal fragment, amino acids 988-1292, …Available SinceMay 9, 2008AvailabilityAcademic Institutions and Nonprofits only -
prhaBAD-anti-mouse-Nb-Hia5
Plasmid#239626PurposeRhamnose inducible expression plasmid for anti-mouse nanobody fusion to Hia5 DNA adenine methyltransferaseDepositorInsertHia5
Tags6HIS, MBP, TEV, and anti-Mouse NanobodyExpressionBacterialMutationCodon optimized for bacterial expressionPromoterrhaBADAvailable SinceJuly 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
pX601-AAV-CMV::NLS-SaCas9-NLS-3xHA-bGHpA;U6::BsaI-sgRNA
Plasmid#61591PurposeA single vector AAV-Cas9 system containing Cas9 from Staphylococcus aureus (SaCas9) and its sgRNA.DepositorInsertshSaCas9
Chimeric guide for SaCas9
UseAAV and CRISPRTags3xHA and NLSExpressionMammalianAvailable SinceFeb. 16, 2015AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-OGT_opt
Plasmid#190858PurposeFor mammalian expression of wild-type full-length human ncOGT. The ncOGT is not epitope-tagged, but is codon-optimized for human cells.DepositorInsertO-GlcNAc Transferase (OGT Human)
ExpressionMammalianMutationCodon optimized for expression in human cells.PromoterCMVAvailable SinceJan. 9, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
pVITRO1-Trastuzumab-IgG1/κ
Plasmid#61883PurposeExpresses HER2/neu receptor specific humanized IgG1/κ antibody isotype (Trastuzumab-IgG1/κ)DepositorInsertsHER2/neu receptor specific humanized Gamma 1 heavy chain expression cassette
HER2/neu receptor specific humanized kappa light chain expression cassette
ExpressionMammalianPromotermEF1 Prom and rEF1 PromAvailable SinceMarch 17, 2015AvailabilityAcademic Institutions and Nonprofits only -
pCAP03-sp44/p21
Plasmid#120232PurposeCarries bidirectional promoter cassette containing sp44 and p21 promoters and apramycin resistance gene flanked by two FRT sites that can be amplified with homology sequence for refactoring.DepositorInsertbidirectional promoter cassette containing sp44 and p21 promoters and apramycin resistance gene flanked by two FRT sites
UseSynthetic BiologyMutationaac(3)IV (apramycin resistance gene)Available SinceMarch 21, 2019AvailabilityAcademic Institutions and Nonprofits only -
MB 101A ttrSR(m13)-sfGFP_mCherry
Plasmid#232474PurposeOptimized tetrathionate sensor with fluorescent reporter (GFP), constitutive mCherryDepositorInsertsttrS
ttrR
PttrB185-269
sfGFP
AxeTxe
mCherry
ExpressionBacterialPromoterConstitutive (TTGATAGCTAGCTCAGTCCTAGGTATTGTGCTAGC…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
Cbh_v5 AAV-CBE N-terminal
Plasmid#137175PurposeAAV genome: expresses the N-terminal of v5 AAV-CBE from the Cbh promoter, and U6-sgRNADepositorInsertv5 AAV-CBE N-terminal; U6-protospacer
UseAAVMutationCas9 D10APromoterCbhAvailable SinceJan. 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
xCIAR_pcDNA5/FRT/TO
Plasmid#86504PurposeExpresses inactive control CIAR (xCIAR) in mammalian cells. Used to generate Flp-In stables.DepositorInsertxCIAR (SOS1 Human)
UseFrtExpressionMammalianMutationF929A and T968L in SOScatPromoterCMV (tet operator)Available SinceFeb. 8, 2017AvailabilityAcademic Institutions and Nonprofits only -
pVITRO1-Trastuzumab-IgG3/κ
Plasmid#61885PurposeExpresses HER2/neu receptor specific humanized IgG3/κ antibody isotype (Trastuzumab-IgG3/κ)DepositorInsertsHER2/neu receptor specific humanized Gamma 3 heavy chain expression cassette
HER2/neu receptor specific humanized kappa light chain expression cassette
ExpressionMammalianPromotermEF1 Prom and rEF1 PromAvailable SinceMarch 17, 2015AvailabilityAcademic Institutions and Nonprofits only -
pVITRO1-102.1F10-IgA1/λ
Plasmid#50370PurposeExpresses grass pollen allergen Phl p 7 specific human IgA1/λ antibody isotype (102.1F10-IgA1/λ)DepositorInsertsgrass pollen allergen Phl p 7 specific human Alpha 1 heavy chain expression cassette
grass pollen allergen Phl p 7 specific human lambda light chain expression cassette
ExpressionMammalianPromoterMouse Elongation Factor 1 Alpha and Rat Elongatio…Available SinceJan. 7, 2014AvailabilityAcademic Institutions and Nonprofits only -
pVITRO1-102.1F10-IgA2/λ
Plasmid#50371PurposeExpresses grass pollen allergen Phl p 7 specific human IgA2/λ antibody isotype (102.1F10-IgA2/λ)DepositorInsertsgrass pollen allergen Phl p 7 specific human Alpha 2 heavy chain expression cassette
grass pollen allergen Phl p 7 specific human lambda light chain expression cassette
ExpressionMammalianPromoterMouse Elongation Factor 1 Alpha and Rat Elongatio…Available SinceApril 1, 2014AvailabilityAcademic Institutions and Nonprofits only -
pCMV_UdgX-APOBEC1-UdgX-NG-nCas9
Plasmid#163562PurposeMammalian CG-to-GC base editingDepositorInsertUdgX-APOBEC1-UdgX-NG-nCas9
UseCRISPRExpressionMammalianMutationnCas9 (D10A)NG (L111R, D1135V, G1218R, E1219F, A1…Available SinceDec. 22, 2020AvailabilityAcademic Institutions and Nonprofits only -
pKS070 - pCAGGS-3XFLAG-(human)CTCF-eGFP
Plasmid#156448PurposeFor transient expression of human CTCF tagged with eGFPDepositorAvailable SinceSept. 2, 2020AvailabilityAcademic Institutions and Nonprofits only