We narrowed to 17,241 results for: BLI
-
Plasmid#178057PurposeExpression Recording Islands (XRIs) for recording cellular physiological histories along intracellular protein self-assembly. Contains XRI subunit with FLAG tag, under UBC promoter with a FLEX switch.DepositorInsertXRI-FLAG
UseAAVTagsFLAG-MBPExpressionMammalianPromoterHuman ubiquitin C (UBC) promoterAvailable SinceOct. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
GBX
Plasmid#64123Purposea modified episomal (EBNA1/OriP) vector expressing human eGFP and BCL-xL genesDepositorAvailable SinceAug. 11, 2015AvailabilityAcademic Institutions and Nonprofits only -
BICstim-Gag-dCAS9-VPR
Plasmid#120922Purposeencodes a GAG-dCAS9-VPR fusion for targeted transcriptional activation.DepositorInsertGAG (FMLV)-dCAS9-VPR
TagsnoneExpressionMammalianPromoterhCMVAvailable SinceApril 9, 2019AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-Flag-NSF/T645A
Plasmid#74936PurposeMammalian expression of human NSF mutant T645A (mutation in the D2 domain of the protein)DepositorInsertNSF (NSF Human)
TagsFLAGExpressionMammalianMutationT645A (mutation in the D2 domain of the protein)PromoterCMVAvailable SinceApril 20, 2016AvailabilityAcademic Institutions and Nonprofits only -
MBX
Plasmid#64122Purposea modified episomal (EBNA1/OriP) vector expressing human BCL2L1 (BCL-xL) geneDepositorAvailable SinceAug. 11, 2015AvailabilityAcademic Institutions and Nonprofits only -
pNL(CMV)Luc2-Turbo RFP/CMV/WPREdU3
Plasmid#136959PurposeReporter vector encoding firefly luciferase and TurboRFP fluorescent proteinDepositorInsertFirefly luciferase and TurboRFP
UseLentiviralTagsV5 tagPromoterCMVAvailable SinceFeb. 7, 2020AvailabilityAcademic Institutions and Nonprofits only -
-
pLV-SspB-HaloTag-p63DH
Plasmid#176129PurposeHeterodimerization with iLID, RhoA activationDepositorInsertRHOGEF p63 (ARHGEF25 Human)
UseLentiviralAvailable SinceFeb. 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-3xsgRNA_Opn1mw-RHO-Cas9N-IntN-polyA
Plasmid#165450PurposeExpress N-terminal part of split dCas9-VPR and 3 sgRNAs targeting murine Opn1mw promoterDepositorInsertsdCas9N-IntN
3x Opn1mw promoter-targeting sgRNAs
UseAAV and CRISPRExpressionMammalianPromoterU6 and short human rhodopsin promoterAvailable SinceDec. 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
SSpB-iRFP-p63DH
Plasmid#176120PurposeHeterodimerization with iLID, RhoA activationDepositorInsertRHOGEF p63 (ARHGEF25 Human)
ExpressionMammalianAvailable SinceOct. 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
FLAG-HA-FbxO11-ΔFbox-pcDNA3.1-
Plasmid#52502Purposeexpresses human FbxO11-ΔFbox in mammalian cells with FLAG-HA tag at N-terminusDepositorInsertFbxO11 (FBXO11 Human)
TagsFLAG-HAExpressionMammalianMutationdeletion of Fbox (deleted aa 71-116)PromoterCMVAvailable SinceJuly 31, 2015AvailabilityAcademic Institutions and Nonprofits only -
pCDF RBP-FL P53
Plasmid#174042PurposeExpress Full length P53 in E.coli with cleavable expression/purification tag (ribose binding protein)DepositorInsertP53 gene (TP53 Human)
TagsThermoanaerobacter Tencongenesis ribose binding p…ExpressionBacterialPromoterT7Available SinceOct. 7, 2021AvailabilityAcademic Institutions and Nonprofits only -
AAVS1 intron 1 gRNA as2
Plasmid#132394PurposeTargets AAVS1 intron 1, gRNA: AGAACCAGAGCCACATTAAC, MLM3636 backboneDepositorAvailable SinceMay 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
peSCBE3-NG
Plasmid#218163PurposeThis plasmid harbors the base editor eSCBE3-NG along with an sgRNA cloning cassette, facilitating high-efficiency cytosine base editing at targets bearing NG PAM in Streptomyces.DepositorInsertsescbe3-NG
a programmable sgRNA cloning cassette
UseCRISPR; Sgrna transcriptionExpressionBacterialMutationMutation in the portion of deaminase hAPOBEC3A : …PromoterrpsL promoterAvailable SinceMay 13, 2024AvailabilityAcademic Institutions and Nonprofits only -
BII-BCA-Prom-ASCL2
Plasmid#133394PurposePiggybac vector for heterologous promoter reporter assay of human ASCL2 promoterDepositorInsertdestabilized tdTomato-NLS and destabilized NLS-GFP
ExpressionMammalianMutationN/APromoterCMV enhancer and hEf1a (CpG free) drives expressi…Available SinceJan. 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSCBE3-NG
Plasmid#218159PurposeThis plasmid harbors the base editor SCBE3-NG along with an sgRNA cloning cassette, facilitating cytosine base editing at targets bearing NG PAM in Streptomyces.DepositorInsertsscbe3-NG
a programmable sgRNA cloning cassette
UseCRISPR; Sgrna transcriptionExpressionBacterialMutationMutations in the portion of SpCas9 : D10A / L1111…PromoterrpsL promoterAvailable SinceMay 13, 2024AvailabilityAcademic Institutions and Nonprofits only -
SSpB-HaloTag-p63DH
Plasmid#176116PurposeHeterodimerization with iLID, RhoA activationDepositorInsertRHOGEF p63 (ARHGEF25 Human)
ExpressionMammalianAvailable SinceOct. 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
SSpB-mCherry-p63DH
Plasmid#176112PurposeHeterodimerization with iLID, RhoA activationDepositorInsertRHOGEF p63 (ARHGEF25 Human)
ExpressionMammalianAvailable SinceOct. 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCDH-EF1-FHC-POLQ-S1977P
Plasmid#64876Purposelentiviral expression of human POLQ S1977P mutant (mimicks the chaos1 mutation)DepositorInsertPOLQ (POLQ Human)
UseLentiviralTagsFLAG and HAExpressionMammalianMutationS1977P, mimicking the chaos1 mutationPromoterEF1alphaAvailable SinceJuly 11, 2016AvailabilityAcademic Institutions and Nonprofits only -
FLAG-HA-FbxO11-Jeff-pcDNA3.1-
Plasmid#52503Purposeexpresses human FbxO11-Jeff mutant in mammalian cells with FLAG-HA tag at N-terminusDepositorAvailable SinceAug. 4, 2015AvailabilityAcademic Institutions and Nonprofits only