We narrowed to 1,644 results for: αGFP
-
Plasmid#198753PurposeCre reporter, which switches from membraneous mTurquoise to nuclear RFP upon Cre recombinase activityDepositorInsertEF1a promotor-Lox2272-LoxP-MARKS-mTurquoise2-NLS.turboRFP-Lox2272-LOXP
UseLentiviralExpressionBacterial and MammalianMutationSee depositor comments belowPromoterEF1aAvailable SinceJuly 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
INCTbiosyn-pEF-GFP(rc)5
Plasmid#127506PurposePlasmid has an EF1 alpha promoter in a forward sequence orientation and an inverted EGFP coding sequence (reverse complement) flanked by attB and attP integrase 5 attachment sites.DepositorInsertEGFP reverse complement coding sequence flanked by attB/attP Integrase 5 attachment sites.
ExpressionMammalianAvailable SinceMay 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
INCTbiosyn-pEF-GFP(rc)7
Plasmid#127507PurposePlasmid has an EF1 alpha promoter in a forward sequence orientation and an inverted EGFP coding sequence (reverse complement) flanked by attB and attP integrase 7 attachment sites.DepositorInsertEGFP reverse complement coding sequence flanked by attB/attP Integrase 7 attachment sites.
ExpressionMammalianAvailable SinceMay 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
INCTbiosyn-pEF-GFP(rc)4
Plasmid#127505PurposePlasmid has an EF1 alpha promoter in a forward sequence orientation and an inverted EGFP coding sequence (reverse complement) flanked by attB and attP integrase 4 attachment sites.DepositorInsertEGFP reverse complement coding sequence flanked by attB/attP Integrase 4 attachment sites.
ExpressionMammalianAvailable SinceMay 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCS2+-Pard3-EGFP-PIF6
Plasmid#154914PurposeFull length zebrafish Pard3 (Gene ID: 403050), tagged with EGFP fluorescent protein and Arabidopsis PIF6 (as in construct Addgene ID 154913).DepositorInsertpar-3 family cell polarity regulator alpha, b (pard3ab Zebrafish)
UseXenopus/avian/zebrafishTags1-100 amino acids of Arabidopsis PIF6 and EGFPExpressionMammalianPromoterCMVAvailable SinceAug. 18, 2020AvailabilityAcademic Institutions and Nonprofits only -
AAV-U6/TO-shEsr1-CMV-TetR-eGFP
Plasmid#233298PurposeDOX-inducible U6 driven shRNA against mouse Esr1DepositorAvailable SinceMarch 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLenti-sgAMPKa2-Cas9-GFP
Plasmid#208050PurposeLentiviral vector expressing Cas9 and an sgRNA targeting AMPKa2DepositorAvailable SinceDec. 16, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLV CMV mCherry-DDX21-V5
Plasmid#175163PurposeLentiviral expression of human DDX21-V5DepositorAvailable SinceJan. 18, 2022AvailabilityAcademic Institutions and Nonprofits only -
pOTTC1789 - pAAV (flox-stop) mGrid1 390F gRNA A EF1a eGFP-KASH
Plasmid#131684PurposeAn adeno-associated viral vector expressing nuclear envelope-embedded eGFP and a Cre-dependent guide RNA for mGrid1DepositorInsertsEGFP-KASH
SpCas9 sgRNA vs mouse GRID1
UseAAVTagsKASHPromoterEF1a and mU6-LSL (Cre dependent)Available SinceJune 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLV-mEGFP-hCTNNA1_DNii domain
Plasmid#234557PurposeCTNNA1 Nii-domain deletion mutantDepositorInsertmEGFP:hCTNNA1_DNii domain (CTNNA1 Human)
UseLentiviralTagsmEGFPMutationDeletion of aa ~165-265PromoterCMVAvailable SinceJune 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLV-mEGFP-hCTNNA1_DM1-domain
Plasmid#234555PurposeCTNNA1 M1-domain deletion mutantDepositorInsertmEGFP:hCTNNA1_DM1-domain (CTNNA1 Human)
UseLentiviralTagsmEGFPMutationDeletion of aa 271-396PromoterCMVAvailable SinceJune 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
PTPRA_deltaD2-GFP fusion
Plasmid#139641PurposeGFP-tagged gene expressionDepositorInsertPTPRA_deltaD2 (PTPRA Human)
TagsGFPExpressionMammalianMutationD2 domain deletionPromoterCMVAvailable SinceMarch 25, 2020AvailabilityAcademic Institutions and Nonprofits only -
PTPRA_deltaD1-GFP fusion
Plasmid#139640PurposeGFP-tagged gene expressionDepositorInsertPTPRA_deltaD1 (PTPRA Human)
TagsGFPExpressionMammalianMutationD1 domain deletionPromoterCMVAvailable SinceMarch 24, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-AICD-NLS-IRES-hrGFP
Plasmid#107543PurposeAAV-mediated expression of AICD (last 50 amino acids of APP) with Nuclear Localisation Signal (NLS: CCAAAAAAGAAGAGAAAGGTA) at C-term end and IRES-mediated co-expression of hrGFPDepositorAvailable SinceMay 1, 2018AvailabilityAcademic Institutions and Nonprofits only -
pN-PITCh-FAID
Plasmid#127885PurposeProvides the repair template with PP2Ac microhomology on each end for PP2Ac N-ter FAID taggingDepositorAvailable SinceJuly 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLVX-RT001-LVB
Plasmid#163381PurposeSecond generation lentiviral vector to express anti-GFP(LaG17) module in the G-baToN systemDepositorInsertLaG17-VEEGFRtm-BFP (LVB)
UseLentiviralTagsBFPExpressionMammalianPromoterEF1AAvailable SinceJan. 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EF1a-Flp-DOG-NW
Plasmid#75469PurposeFlp recombinase dependent on GFP (Flp-DOG) for rAAV production and expression in mammalian cellsDepositorHas ServiceAAV1InsertFlp-DOG
UseAAV and Synthetic BiologyExpressionMammalianPromoterEF-1aAvailable SinceApril 25, 2017AvailabilityAcademic Institutions and Nonprofits only -
pET22b Ag43 160N 6H sfGFP-R5 AmpR
Plasmid#225139PurposeRecombinant Ag43 protein fused to silaffin-R5 and sfGFP. pelB as the periplasmic signal. His-tag for purification. TEV enzyme recognition site between Ag43 alpha subunit and the fluorescent protein.DepositorInsertAg43 protein fused to silaffin-R5 and sfGFP
TagsHis tagExpressionBacterialPromoterT7Available SinceFeb. 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-AICD-NES-IRES-hrGFP
Plasmid#107544PurposeAAV-mediated expression of AICD (last 50 amino acids of APP) with Nuclear Export Signal (NES: CTCCCTCCACTAGAGCGACTAACCTTA) at C-term end and IRES-mediated co-expression of hrGFPDepositorAvailable SinceMay 2, 2018AvailabilityAcademic Institutions and Nonprofits only -
GFP(N-glyc)-Tac-TC
Plasmid#162496PurposeExpresses partial length Tac (TMD and cytosolic tail) with GFP tag in the N-terminus in mammalian cells, and there is one N-glycosylation site in GFP tag.DepositorInsertpartial length Tac (TMD and cytosolic tail) (IL2RA Human)
TagsGFPExpressionMammalianMutationTac is in partial length with its TMD and cysotol…Available SinceJan. 29, 2021AvailabilityAcademic Institutions and Nonprofits only