We narrowed to 19,941 results for: INO
-
Plasmid#200469PurposeLentiviral vector expressing gRNA targeting human ARID1BDepositorInsertARID1B(21) (ARID1B Human)
UseLentiviralAvailable SinceJan. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(CXCR4-SE(95))-PGKpuro2ABFP-W
Plasmid#200476PurposeLentiviral vector expressing gRNA targeting human CXCR4-SEDepositorInsertCXCR4-SE(95) (CXCR4 Human)
UseLentiviralAvailable SinceJan. 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(CXCR4-E4(59))-PGKpuro2AmCherry-W
Plasmid#210615PurposeLentiviral vector expressing gRNA targeting human CXCR4-E4DepositorInsertCXCR4-E4(59) (CXCR4 Human)
UseLentiviralAvailable SinceJan. 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(CXCR4-E4(56))-PGKpuro2AmCherry-W
Plasmid#210614PurposeLentiviral vector expressing gRNA targeting human CXCR4-E4DepositorInsertCXCR4-E4(56) (CXCR4 Human)
UseLentiviralAvailable SinceJan. 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(CXCR4-E3(45))-PGKpuro2ABFP-W
Plasmid#200482PurposeLentiviral vector expressing gRNA targeting human CXCR4-E3DepositorInsertCXCR4-E3(45) (CXCR4 Human)
UseLentiviralAvailable SinceJan. 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(CXCR4-E1(16))-PGKpuro2ABFP-W
Plasmid#200479PurposeLentiviral vector expressing gRNA targeting human CXCR4-E1DepositorInsertCXCR4-E1(16) (CXCR4 Human)
UseLentiviralAvailable SinceJan. 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(ARID1A(42))-PGKpuro2ABFP-W
Plasmid#200467PurposeLentiviral vector expressing gRNA targeting human ARID1ADepositorInsertARID1A(42) (ARID1A Human)
UseLentiviralAvailable SinceJan. 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(CXCR4-E4(59))-PGKpuro2ABFP-W
Plasmid#200485PurposeLentiviral vector expressing gRNA targeting human CXCR4-E4DepositorInsertCXCR4-E4(59) (CXCR4 Human)
UseLentiviralAvailable SinceJan. 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(ARID1A(44))-PGKpuro2ABFP-W
Plasmid#200468PurposeLentiviral vector expressing gRNA targeting human ARID1ADepositorInsertARID1A(44) (ARID1A Human)
UseLentiviralAvailable SinceJan. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(CXCR4-E2(37))-PGKpuro2ABFP-W
Plasmid#200480PurposeLentiviral vector expressing gRNA targeting human CXCR4-E2DepositorInsertCXCR4-E2(37) (CXCR4 Human)
UseLentiviralAvailable SinceJan. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(CXCR4-SE(96))-PGKpuro2ABFP-W
Plasmid#200477PurposeLentiviral vector expressing gRNA targeting human CXCR4-SEDepositorInsertCXCR4-SE(96) (CXCR4 Human)
UseLentiviralAvailable SinceJan. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCDH-V1-rCD20-BSD
Plasmid#209752PurposeTo reconstitute CD20 expression with a specific mRNA isoform (variant 1) after CRISPR-Cas9-mediated knockout of CD20.DepositorInsertMS4A1 (MS4A1 Human)
UseLentiviralMutationThe CCTGGGGGGTCTTCTGATGATCC sequence within the C…Available SinceNov. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCDH-V2-rCD20-BSD
Plasmid#209753PurposeTo reconstitute CD20 expression with a specific mRNA isoform (variant 2) after CRISPR-Cas9-mediated knockout of CD20.DepositorInsertMS4A1 (MS4A1 Human)
UseLentiviralMutationThe CCTGGGGGGTCTTCTGATGATCC sequence within the C…Available SinceNov. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCDH-V3-rCD20-BSD
Plasmid#209754PurposeTo reconstitute CD20 expression with a specific mRNA isoform (variant 3) after CRISPR-Cas9-mediated knockout of CD20.DepositorInsertMS4A1 (MS4A1 Human)
UseLentiviralMutationThe CCTGGGGGGTCTTCTGATGATCC sequence within the C…Available SinceNov. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
mGFP-hNET-A457P
Plasmid#193365Purposeexpression of mutated human norpinephrine transporter tagged with monomeric GFP at the N-terminus in mammalian cellsDepositorInserthuman Norepinephrine Transporter (A457P mutation) (SLC6A2 Human)
Tagsmonomeric GFP (mGFP)ExpressionMammalianMutationA457P (GCC to CCC)PromoterCMVAvailable SinceJan. 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
mGFP-hNET-R121A/K334A/R440A
Plasmid#193366Purposeexpression of mutated human norpinephrine transporter tagged with monomeric GFP at the N-terminus in mammalian cellsDepositorInserthuman Norepinephrine Transporter (SLC6A2 Human)
Tagsmonomeric GFP (mGFP)ExpressionMammalianMutationR121A (CGG to GCG) K334A (AAA to GCA) R440A (CGA …PromoterCMVAvailable SinceJan. 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(hCHAT)-PGKpuro2ABFP-W
Plasmid#163147PurposeLentiviral gRNA plasmid targeting human CHAT gene, co-expression of BFP tagDepositorAvailable SinceOct. 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(hWWTR1-W2B)-PGKpuro2ABFP-W
Plasmid#163175PurposeLentiviral gRNA plasmid targeting human WWTR1 gene, co-expression of BFP tagDepositorAvailable SinceSept. 16, 2022AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(hWWTR1-W1K)-PGKpuro2ABFP-W
Plasmid#163174PurposeLentiviral gRNA plasmid targeting human WWTR1 gene, co-expression of BFP tagDepositorAvailable SinceSept. 16, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCAG-eSpCas9-2A-GFP-sgRNA-RDH11
Plasmid#161924PurposeTo generate RDH11 KO in human cells. Co-expresses eSpCas9(1.1), GFP and a guide RNA against RDH11 exon 2.DepositorInsertsgRNA targeting RDH11 exon 2
UseCRISPRExpressionMammalianPromoterU6Available SinceMay 12, 2022AvailabilityAcademic Institutions and Nonprofits only