We narrowed to 15,760 results for: LIS
-
Plasmid#166851PurposeExpresses mutant E141D ATG5, HA-ATG12 ATG16 in yeast.DepositorAvailable SinceApril 5, 2021AvailabilityAcademic Institutions and Nonprofits only
-
TC1464
Plasmid#164881PurposeCMV-bpNLS-dCas13d-bpNLS-ADARdd, ADARdd embeded in loop1DepositorInsertdcas13d-ADARdd
UseCRISPRExpressionMammalianPromoterCMVAvailable SinceMarch 2, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAWp40
Plasmid#157980PurposepFUGW-EFSp-BFP-{SbfI}DepositorTypeEmpty backboneUseLentiviralAvailable SinceNov. 25, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLV-Hyg-Snrnp40-CRISPR-resistant
Plasmid#134251PurposeLentivector encoding CRISPR-resistant Snrnp40DepositorInsertSnrp40 (Snrnp40 Mouse)
UseLentiviralExpressionMammalianMutationmutated coding sequence “gataactatgcgacgttgaa” to…PromoterEF1aAvailable SinceMarch 19, 2020AvailabilityAcademic Institutions and Nonprofits only -
px330-RPL26 sgRNA2
Plasmid#134642Purposecontains sgRNA targeting to the C-terminus of human RPL26 for gene editingDepositorInsertRPL26 sgRNA2 (RPL26 Human)
ExpressionMammalianAvailable SinceDec. 3, 2019AvailabilityAcademic Institutions and Nonprofits only -
px330-RPL26 sgRNA1
Plasmid#134641Purposecontains sgRNA targeting to the C-terminus of human RPL26 for gene editingDepositorInsertRPL26 sgRNA2 (RPL26 Human)
ExpressionMammalianAvailable SinceDec. 3, 2019AvailabilityAcademic Institutions and Nonprofits only -
human ETV6 gRNA-1
Plasmid#133353Purposehuman ETV6 gRNA-1 is a gRNA expression plasmid. Its 20-nt specific sequence targets the first ETV6 exon.DepositorAvailable SinceOct. 30, 2019AvailabilityAcademic Institutions and Nonprofits only -
pET-Duet-ECHA(37-763)-FLAG (no His-tag)
Plasmid#96887Purposeexpresses flag-tagged mouse ECHA (37-768) in E.coli cells (no His-tag)DepositorInsertTrifunctional enzyme subunit alpha, mitochondrial (Hadha Mouse)
TagsFLAG-taggedExpressionBacterialMutationdeleted amino acid 1-36PromoterT7Available SinceJuly 20, 2019AvailabilityAcademic Institutions and Nonprofits only -
pVL94 - pOp4:VND7
Plasmid#116016Purposedestination vector for GreenGate cloning method, "Effector line", crossed with a "Driver line" the GOI, here VND7, will be expressed upon Dex-inductionDepositorInsertpOp4:B-dummy:VND7:VP16:tUBQ10::BastaR
ExpressionPlantAvailable SinceJuly 9, 2019AvailabilityAcademic Institutions and Nonprofits only -
pANY1
Plasmid#110949PurposeUniversal mini-vector for efficient cloning of DNA and expression of protein in E. coli.DepositorInsertccd B cassette
TagsHisExpressionBacterialPromoterT7Available SinceJune 15, 2018AvailabilityAcademic Institutions and Nonprofits only -
Px458-Cas9n-Trp73-Exon4-3sgRNA
Plasmid#88850PurposeCRISPR KO of Trp73DepositorAvailable SinceJuly 11, 2017AvailabilityAcademic Institutions and Nonprofits only -
Px458-Cas9n-Trp73-Exon4-4sgRNA
Plasmid#88851PurposeCRISPR KO of Trp73DepositorAvailable SinceJuly 11, 2017AvailabilityAcademic Institutions and Nonprofits only -
pETDuet-msGC-NT21
Plasmid#78102Purposeexpresses the N-terminal fragment of manduca sexta soluble guanylyl cyclase subunits alpha and betaDepositorInsertsfragment of alfa subunit of sGC
fragment of beta subunit of sGC
TagsHis-tagExpressionBacterialMutationfragment 1-380 of the beta subunit and fragment 2…PromoterT7Available SinceJune 30, 2016AvailabilityAcademic Institutions and Nonprofits only -
POT11-RFP
Plasmid#65327Purposereceiving vector of standard transcription units(TUs) in YeastFab work, useful for further assemblyDepositorInsertRFP
UseSynthetic BiologyAvailable SinceFeb. 26, 2016AvailabilityAcademic Institutions and Nonprofits only -
POT5-RFP
Plasmid#65321Purposereceiving vector of standard transcription units(TUs) in YeastFab work, useful for further assemblyDepositorInsertRFP
UseSynthetic BiologyAvailable SinceFeb. 19, 2016AvailabilityAcademic Institutions and Nonprofits only -
POT3-RFP
Plasmid#65319Purposereceiving vector of standard transcription units(TUs) in YeastFab work, useful for further assemblyDepositorInsertRFP
UseSynthetic BiologyAvailable SinceFeb. 16, 2016AvailabilityAcademic Institutions and Nonprofits only -
POT9-RFP
Plasmid#65325Purposereceiving vector of standard transcription units(TUs) in YeastFab work, useful for further assemblyDepositorInsertRFP
UseSynthetic BiologyAvailable SinceFeb. 16, 2016AvailabilityAcademic Institutions and Nonprofits only -
pICSL11061
Plasmid#68255PurposeLevel 1 Golden Gate Cassette: sgRNA cassette targeting BolC.GA4a-1 in Brassica oleraceaDepositorInsertPromoter_AtU6-26 + sgRNA_BolC.GA4a-1
UseSynthetic BiologyExpressionPlantAvailable SinceAug. 20, 2015AvailabilityAcademic Institutions and Nonprofits only -
pet23a_RBPMS_20_101
Plasmid#65733Purposeplasmid for bacterial overexpression of RBPMSDepositorInsertRBPMS (RBPMS Human)
TagsHis TagExpressionBacterialMutationdeletion construct encoding amino acids 20-101PromoterT7Available SinceAug. 13, 2015AvailabilityAcademic Institutions and Nonprofits only -
pet23a_RBPMS_1_101
Plasmid#65728Purposeplasmid for bacterial overexpression of RBPMSDepositorInsertRBPMS (RBPMS Human)
TagsHis TagExpressionBacterialMutationdeletion construct encoding amino acids 1-101PromoterT7Available SinceAug. 13, 2015AvailabilityAcademic Institutions and Nonprofits only