We narrowed to 16,609 results for: grna
-
Plasmid#169838PurposeExpresses FnCas12a and guide RNA in BacteriaDepositorInsertFnCas12a
UseCRISPRExpressionBacterialPromoterpXynAAvailable SinceJune 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
pX330-PITCh-PXN
Plasmid#227315PurposeExpresses SpCas9, the PITCh gRNA, and a sgRNA targeting the C-terminus of PXN for knock-in.DepositorAvailable SinceNov. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
pJZC588
Plasmid#62315PurposesgRNA with 2x MS2 (wt+f6) for yeast cellsDepositorInsertsgRNA + 2x MS2 (wt+f6) binding module
ExpressionYeastPromoterSNR52Available SinceApril 3, 2015AvailabilityAcademic Institutions and Nonprofits only -
lentiGuide-RRBP1-1
Plasmid#92156PurposeCRISPR guide RNA targeting human RRBP1DepositorInsertRRBP1 sgRNA-1
UseCRISPR and LentiviralExpressionMammalianPromoterhU6Available SinceMarch 15, 2019AvailabilityAcademic Institutions and Nonprofits only -
pU6_(GLuc)_INT[3xPP7_SL]
Plasmid#68424PurposeTransient expression of an "INT" construct_bearing three PP7 Stem-loops, targeting the GLuc reporter, in mammalian cells. U6 promoterDepositorInsertINT construct bearing three PP7 Stem-loops
UseCRISPR and Synthetic BiologyExpressionMammalianPromoterhuman U6Available SinceOct. 5, 2015AvailabilityAcademic Institutions and Nonprofits only -
pX-EGFP-g1
Plasmid#107273PurposeeGFP sgRNA-1 and Cas9 expression vector (aka. pX-ps1)DepositorInsertGFP sgRNA-1
UseCRISPRExpressionMammalianPromoterU6Available SinceMarch 15, 2018AvailabilityAcademic Institutions and Nonprofits only -
pJZC603
Plasmid#62317PurposesgRNA with 2x PP7 for yeast cellsDepositorInsertsgRNA + 2x PP7 RNA binding module
ExpressionYeastPromoterSNR52Available SinceMarch 18, 2015AvailabilityAcademic Institutions and Nonprofits only -
lentiGuide-RRBP1-2
Plasmid#92157PurposeCRISPR guide RNA targeting human RRBP1DepositorInsertRRBP1 sgRNA-2
UseCRISPR and LentiviralExpressionMammalianPromoterhU6Available SinceSept. 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
pX330-PITCh-MYO1C
Plasmid#227305PurposeExpresses SpCas9, the PITCh gRNA, and a sgRNA targeting the N-terminus of MYO1C for knock-in.DepositorInsertsgRNA Targeting N-terminus of MYO1C (MYO1C Human)
UseCRISPRExpressionMammalianPromoterU6Available SinceNov. 13, 2024AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPR-sgUFM1
Plasmid#86133PurposeLentiviral vector expressing Cas9 and an sgRNA targeting UFM1DepositorAvailable SinceFeb. 22, 2017AvailabilityAcademic Institutions and Nonprofits only -
pJZC545
Plasmid#62313PurposesgRNA with 1x MS2 for yeast cellsDepositorInsertsgRNA + 1x MS2 binding module
ExpressionYeastPromoterSNR52Available SinceMay 8, 2015AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9(BB)-2A-GFP-G3BP2(1)
Plasmid#136060PurposeG3BP2 gRNA (#1) inserted into the pSpCas9(BB)-2A-GFP plasmid (TCATACTAAAATTCGTCATG)DepositorInsertG3BP2 (G3BP2 Human)
ExpressionMammalianAvailable SinceApril 24, 2020AvailabilityAcademic Institutions and Nonprofits only -
pMOD_B2615
Plasmid#91078PurposeModule B, Promoter: AtU6, Gene: BsaI ccdb cassette for single gRNA spacer cloning, Terminator: Pol IIIDepositorInsertBsaI ccdb cassette for single gRNA spacer cloning
UseCRISPRPromoterAtU6Available SinceJuly 13, 2017AvailabilityAcademic Institutions and Nonprofits only -
pTX209
Plasmid#89269PurposeExpress STU Cas9 with Maize Ubiquitin1 promoter in rice targeting OsPDS gene, OsPDS-gRNA01 and OsPDS-gRNA02DepositorInsertOsPDS-gRNA01 and OsPDS-gRNA02
UseCRISPRTagsSV40 NLSExpressionPlantPromoterMaize Ubiquitin1 promoterAvailable SinceMay 8, 2017AvailabilityAcademic Institutions and Nonprofits only -
pUD628
Plasmid#103018Purposeexpression of a Cpf1 programming crRNA targetting ADE2 (crADE2-3.S)DepositorAvailable SinceDec. 1, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPRv2-dADAM17 (#1)
Plasmid#177259PurposeA knockout vector for the dog Adam17DepositorInsertA gRNA targeting the dog Adam17 gene and the cDNA of CRISPR-Cas9
UseCRISPR and LentiviralExpressionMammalianAvailable SinceJan. 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSBbi-Pur-dCas9-KRAB-MeCP2_hU6-A10
Plasmid#196079PurposeConstitutive CRISPRi vector conferring puromycin resistance, expressing gRNA targeting mouse Adam10.DepositorInsertgRNA targeting Adam10
UseCRISPRExpressionMammalianMutationCloned using SapI sites - destroyed after insertiā¦Available SinceMarch 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPR-sgUFSP2
Plasmid#86134PurposeLentiviral vector expressing Cas9 and an sgRNA targeting UFSP2DepositorAvailable SinceMay 15, 2017AvailabilityAcademic Institutions and Nonprofits only -
pSB700 HL1gR4
Plasmid#124450PurposeExpresses gRNA HL1 gR4 in the pSB700 backboneDepositorInsertHL1 gR4
UseCRISPR and LentiviralExpressionMammalianAvailable SinceApril 10, 2019AvailabilityAcademic Institutions and Nonprofits only -
pMOD_B2517
Plasmid#91074PurposeModule B, Promoter: TaU3, Gene: Esp3I ccdb cassette for single gRNA spacer cloning, Terminator: Pol IIIDepositorInsertEsp3I ccdb cassette for single gRNA spacer cloning
UseCRISPRPromoterTaU3Available SinceJuly 13, 2017AvailabilityAcademic Institutions and Nonprofits only