We narrowed to 2,171 results for: Pam
-
Plasmid#101730PurposeExpresses a sgRNA and a Cas9 VQR variant that recognizes "NGA" PAM motifsDepositorInsertSpCas9 VQR
Tags3xFLAG-NLS and NLSExpressionMammalianMutationVQR (D1135V, R1335Q, and T1337R mutations in Cas9)Available SinceOct. 17, 2017AvailabilityAcademic Institutions and Nonprofits only -
M-tdTom-NM
Plasmid#48679PurposeMammalian tdTomato activation reporter for NM with GTCCCCTCCACCCCACAGTG protospacerDepositorInsertTAL binding site w/ GTCCCCTCCACCCCACAGTG protospacer, NM-PAM, and tdTomato reporter. Compatible with N. meningitidis Cas9
UseCRISPRPromoterSp6Available SinceOct. 22, 2013AvailabilityAcademic Institutions and Nonprofits only -
pJEC581
Plasmid#174369PurposeRFP reporter used to evaluate CRISPRa in bacteria, contains gRNA target sites every 10 bp upstream of the promoter.DepositorInsertRFP with PAM rich sequence upstream promoter
UseSynthetic BiologyExpressionBacterialPromoterJ23117Available SinceOct. 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
M-tdTom-ST1
Plasmid#48678PurposeMammalian tdTomato activation reporter for ST1 with GTCCCCTCCACCCCACAGTG protospacerDepositorInsertTAL binding site w/ GTCCCCTCCACCCCACAGTG protospacer, ST1-PAM, and tdTomato reporter. Compatible with S. thermophilus #1 Cas9
UseCRISPRPromoterSp6Available SinceOct. 22, 2013AvailabilityAcademic Institutions and Nonprofits only -
px330 EQR
Plasmid#101733PurposeExpresses a sgRNA and a Cas9 EQR variant that recognizes "NGAG" PAM motifsDepositorInsertSpCas9 EQR
Tags3xFLAG-NLS and NLSExpressionMammalianMutationEQR (D1135E, R1335Q, and T1337R mutations in Cas9)Available SinceOct. 17, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAGK43
Plasmid#222223PurposeEdits NPAS2 Gene.DepositorAvailable SinceJuly 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
CSM160
Plasmid#105684PurposePlasmid containing an RFP dropout used to construct randomized PAM libraryDepositorInsertRFP Golden Gate dropout
ExpressionBacterialPromoterBba_R0040 TetR PromoterAvailable SinceMarch 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
pYPQAT09
Plasmid#223381PurposeT-DNA vector for SpRY mediated mutagenesis for dicot plants; NG or NA PAM preference; SpRY was driven by 2x35s and the sgRNA was driven by AtU3 promoter; Kanamycin for plants selection.DepositorInsert2x35s-SpRY-AtU3-gRNA scaffold
UseCRISPRTags3x FLAG and NLSExpressionPlantAvailable SinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYPQAT01
Plasmid#223373PurposeT-DNA vector for SpCas9 mediated mutagenesis for dicot plants; NGG PAM; Cas9 was driven by AtUBQ10 and the sgRNA was driven by AtU3 promoter; Hygromycin for plants selection.DepositorInsertAtUBQ10-SpCas9-AtU3-gRNA scaffold
UseCRISPRTags3x FLAG and NLSExpressionPlantAvailable SinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYPQAT05
Plasmid#223377PurposeT-DNA vector for SpCas9 mediated mutagenesis for monocot plants; NGG PAM; Cas9 was driven by ZmUbi1 and the sgRNA was driven by OsU3 promoter; BASTA for plants selection.DepositorInsertZmUbi-SpCas9-OsU3-gRNA scaffold
UseCRISPRTags3x FLAG and NLSExpressionPlantAvailable SinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYPQAT10
Plasmid#223382PurposeT-DNA vector for SpRY mediated mutagenesis for monocot plants; NG or NA PAM preference; SpRY was driven by ZmUbi1 and the sgRNA was driven by OsU3 promoter; Hygromycin for plants selection.DepositorInsertZmUbi-SpRY-OsU3-gRNA scaffold
UseCRISPRTags3x FLAG and NLSExpressionPlantAvailable SinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYPQAT11
Plasmid#223383PurposeT-DNA vector for SpRY mediated mutagenesis for monocot plants; NG or NA PAM preference; SpRY was driven by ZmUbi1 and the sgRNA was driven by OsU3 promoter; BASTA for plants selection.DepositorInsertZmUbi-SpRY-OsU3-gRNA scaffold
UseCRISPRTags3x FLAG and NLSExpressionPlantAvailable SinceJuly 21, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYPQAT08
Plasmid#223380PurposeT-DNA vector for SpRY mediated mutagenesis for dicot plants; NG or NA PAM preference; SpRY was driven by ZmUbi1 and the sgRNA was driven by AtU3 promoter; BASTA for plants selection.DepositorInsertZmUbi-SpRY-AtU3-gRNA scaffold
UseCRISPRTags3x FLAG and NLSExpressionPlantAvailable SinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYPQAT07
Plasmid#223379PurposeT-DNA vector for SpRY mediated mutagenesis for dicot plants; NG or NA PAM preference; SpRY was driven by AtUBQ10 and the sgRNA was driven by AtU3 promoter; Hygromycin for plants selection.DepositorInsertAtUBQ10-SpRY-AtU3-gRNA scaffold
UseCRISPRTags3x FLAG and NLSExpressionPlantAvailable SinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
hJAM-A pcDNA3.1
Plasmid#70073PurposeExpresses human junctional adhesion molecule-A in mammalian cellsDepositorAvailable SinceOct. 21, 2015AvailabilityAcademic Institutions and Nonprofits only -
miniCMV eGFP hPGK BSD
Plasmid#188519PurposeBackbone for CRISPR activation (CRISPRa) isogenic PAM testingDepositorTypeEmpty backboneUseLentiviralTagseGFPExpressionMammalianAvailable SinceSept. 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pYPQAT03
Plasmid#223375PurposeT-DNA vector for SpCas9 mediated mutagenesis for dicot plants; NGG PAM; Cas9 was driven by 2x35s and the sgRNA was driven by AtU3 promoter; Kanamycin for plants selection.DepositorInsert2x35s-SpCas9-AtU3-gRNA scaffold
UseCRISPRTags3x FLAG and NLSExpressionPlantAvailable SinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMS30: pTarget(PmcCAST)
Plasmid#168163PurposeTarget plasmid containing PmcPSP1 and attachment site for PmcCAST.DepositorInsertsPAM for PmcCAST + PmcPSP1
tRNA-Val
ExpressionBacterialAvailable SinceJune 2, 2021AvailabilityAcademic Institutions and Nonprofits only -
p2T-CMV-eA3AmaxNG-BlastR
Plasmid#152999PurposeC-to-T base editor, NG PAMDepositorInserteA3A-nSpCas9 NG-UGI-UGI
UseCRISPRExpressionMammalianPromoterCMVAvailable SinceJuly 1, 2020AvailabilityAcademic Institutions and Nonprofits only -
EFS eGFP hPGK BSD
Plasmid#188520PurposeBackbone for CRISPR interference (CRISPRi) isogenic PAM testingDepositorTypeEmpty backboneUseLentiviralTagseGFPExpressionMammalianAvailable SinceSept. 29, 2022AvailabilityAcademic Institutions and Nonprofits only