We narrowed to 25,226 results for: promoter
-
Plasmid#21199DepositorAvailable SinceJuly 24, 2009AvailabilityAcademic Institutions and Nonprofits only
-
lentiCRISPR - EGFP sgRNA 3
Plasmid#51762PurposeExpresses human codon-optimized Cas9 protein and puromycin resistance from EFS promoter and an EGFP targeting synthetic single-guide RNA (sgRNA) element from U6 promoter. Lentiviral backbone.DepositorInsertsCas9
Puromycin resistance
EGFP sgRNA 3
UseCRISPR and LentiviralExpressionMammalianPromoterEFS and U6Available SinceMarch 11, 2014AvailabilityAcademic Institutions and Nonprofits only -
FLAG-β-arrestin2 RRK/Q-5-kinase domain fusion protein (RRK5K)
Plasmid#38262DepositorInsertβ-arrestin2 (Arrb2 Rat)
TagsFlag and PIP5K Iα core kinase domain (residues 18…ExpressionMammalianMutationArg 233, Arg237, and Lys251 converted to Glutamin…PromoterCMVAvailable SinceAug. 28, 2012AvailabilityAcademic Institutions and Nonprofits only -
NSP4-WT-Flag
Plasmid#210339PurposeExpresses SARS-CoV-2 NSP4 fused with Flag in mammalian cellsDepositorInsertSARS-CoV-2 NSP4 (ORF1ab SARS-CoV-2 isolate Wuhan-Hu-1, Human)
TagsFlagExpressionMammalianMutationMany synonymous changes due to codon optimizationAvailable SinceJan. 3, 2024AvailabilityAcademic Institutions and Nonprofits only -
HA-Rab8a-DN (T22N)
Plasmid#101049PurposeExpresses HA-tagged human Rab8-DN (T22N) in mammalian cellsDepositorAvailable SinceOct. 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLX317 CALM2
Plasmid#193684PurposeConstitutive lentiviral expression of CALM2DepositorInsertCALM2 (CALM2 Human)
UseLentiviralAvailable SinceDec. 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1 6B codon-optimized NLRP1 CARD-mCherry WT
Plasmid#163991PurposeMammalian expression vector encoding codon-optimized human NLRP1 CARD with a C-terminal mCherry tag for imagingDepositorAvailable SinceFeb. 12, 2021AvailabilityAcademic Institutions and Nonprofits only -
pGL410-BRN2p
Plasmid#110733PurposeLuciferase reporter for the human BRN2 promoterDepositorAvailable SinceJuly 25, 2018AvailabilityAcademic Institutions and Nonprofits only -
pTarget: Ptaq-RFP_PlacIq-GFP
Plasmid#192280PurposeRFP expressed under constitutive promoter Ptaq and GFP expressed under constitutive promoter PlaciqDepositorInsertsRFP
GFP
ExpressionBacterialPromoterPlacIq and PtaqAvailable SinceMay 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAcUW51-gEgIL
Plasmid#11622DepositorInsertHSV-1 glycoprotein E and HSV-1 glycoprotein I
TagsHisExpressionInsectMutationDicistronic vector containing HSV-1 gE (KOS strai…Available SinceApril 6, 2007AvailabilityAcademic Institutions and Nonprofits only -
pDN-D2irTNG4kwh
Plasmid#44722DepositorInsertspCMV-D2i promoter
htetR::NLS::EGFP
UseSynthetic Biology; Expression regulator/reporter;…TagsRabbit β-globin intron II and WPREExpressionMammalianMutationInitiator motif (Inr) displaced relative to pCMV-…PromoterpCMV-D2iAvailable SinceApril 23, 2013AvailabilityAcademic Institutions and Nonprofits only -
L40C-CRISPR.EFS.mNeon
Plasmid#69146PurposeLentiviral CRISPR-Cas9 delivery for SpCas9 and sgRNA (hU6), mNeon coexpression, EFS Promoter drivenDepositorInsertsUseCRISPR and LentiviralTagsFLAGAvailable SinceJune 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
ASC-CASP1 Octamer
Plasmid#164032PurposeBacterial expression vector encoding a 5GSS-linked ASC(CARD)-CASP1(CARD) construct to express an octamerDepositorTagsHis6-MBP-TEVExpressionBacterialMutationW169G (ASC), G20K (CASP1)Available SinceFeb. 19, 2021AvailabilityAcademic Institutions and Nonprofits only -
HA-HIF2α P405A/P531A/N847A-pBabe-Puro
Plasmid#25956DepositorInsertHypoxia inducible factor 2 alpha (EPAS1 Human)
UseRetroviralTagsHA-tagExpressionMammalianMutationcDNA changed amino acids: Proline 405 to Alanin…Available SinceOct. 19, 2010AvailabilityAcademic Institutions and Nonprofits only -
pLenti-SwitchON-sgVRK1
Plasmid#199638PurposeTamoxifen-inducible expression of sgRNA targeting VRK1DepositorInsertN/A (VRK1 Human)
UseLentiviralAvailable SinceJune 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1 6A NLRP1 UPA-CARD-FLAG WT
Plasmid#163979PurposeMammalian expression vector encoding human NLRP1 UPA-CARD with a C-terminal FLAG tagDepositorAvailable SinceJan. 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
pRetroX-TRE3G-PLOD2_PGK-GpNLuc
Plasmid#136457PurposeExpresses Tet/Dox-inducible human PLOD2 in mammalian cells.DepositorInsertTRE3G::PLOD2-T2A-Hygromycin (PLOD2 Human)
UseLuciferase and RetroviralExpressionMammalianPromoterTRE3GAvailable SinceJune 7, 2021AvailabilityAcademic Institutions and Nonprofits only -
LentiCas9-sgVRK1 #1-Blast
Plasmid#199646PurposeExpresses Cas9 and sgRNA guide targeting VRK1DepositorInsertN/A (VRK1 Human)
UseLentiviralAvailable SinceMay 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shB3GNT5.1
Plasmid#110325PurposeTRCN0000034809 (Target GCCTATGTAATCTCCGGTGAT), silence human B3GNT5 gene and express monomeric Kusabira-Orange2DepositorInsertB3GNT5 (B3GNT5 Human)
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceJune 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-FLAG-mTET2 (N1041)
Plasmid#89737PurposeExpresses the N1041 truncation to mouse TET2 in mammalian cellsDepositorInsertTET2 (Tet2 Mouse)
TagsFlagExpressionMammalianMutationN-term 1041 truncation of mouse TET2 (contains fi…Available SinceMay 3, 2017AvailabilityAcademic Institutions and Nonprofits only