We narrowed to 41,361 results for: Eras
-
Plasmid#41723DepositorInsertHes1 Promoter (-467 to +46) (Hes1 Mouse)
UseLuciferaseTagsFirefly luciferaseExpressionMammalianMutationContains the murine Hes1 promoter (-467 to +46)PromoterHes1 promoter fragment (-467 to +46)Available SinceMarch 20, 2013AvailabilityAcademic Institutions and Nonprofits only -
MBP-hnRNPA2_FL_WT
Plasmid#98662PurposeExpresses MBP-tagged full length hnRNPA2DepositorAvailable SinceJan. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pF142 pAcGFP1 SOD1 A4V
Plasmid#26403DepositorAvailable SinceNov. 8, 2010AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shGFP
Plasmid#110318PurposeControl (Target CAAGCTGACCCTGAAGTTCAT), silence GFP and express monomeric Kusabira-Orange2DepositorInsertGFP
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceAug. 13, 2018AvailabilityAcademic Institutions and Nonprofits only -
pUFlip-floxed2A-mRFP-; HE1A:BFP -0
Plasmid#180007PurposeDonor for generating conditional alleles in zebrafish using precise CRISPR directed genomic integration with the GeneWeld methodDepositorInsert2A-mRFP; HE1A: BFP
UseSynthetic BiologyAvailable SinceFeb. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV_GR-RE_MLPmin_BC1092-luc2
Plasmid#227112PurposeGlucocorticoid receptor response element for luciferase and barcode assays; barcode BC1092DepositorInsert12x clustered GR response element linked to MLP minimal promoter driving barcode 1092 and a luciferase reporter gene
UseAAVExpressionMammalianAvailable SinceDec. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pUFlip-floxed2A-mRFP-; HE1A:BFP -1
Plasmid#180008PurposeDonor for generating conditional alleles in zebrafish using precise CRISPR directed genomic integration with the GeneWeld methodDepositorInsert2A-mRFP; HE1A: BFP
UseSynthetic BiologyAvailable SinceFeb. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCI-MS2V5-eIF4G delN83
Plasmid#65812Purposeexpression of eIF4G-MS2 fusion.DepositorInserteIF4G (EIF4G1 Human)
TagsMS2 stem loops and V5ExpressionMammalianMutationdelN83 (functionally behaves as the WT protein)PromoterCMVAvailable SinceSept. 17, 2015AvailabilityAcademic Institutions and Nonprofits only -
pIZ-EGFP-MYO10-HMM
Plasmid#87257PurposeExpression plasmid to perform NanoSPD assays in insect cells (generates EGFP-tagged bait).DepositorInsertMYO10 (Myo10 Mouse)
ExpressionInsectMutationMyo10 is truncated to contain aa.1-941PromoterOpIE2Available SinceApril 10, 2017AvailabilityAcademic Institutions and Nonprofits only -
pNOC_hfnCas12a_CRATES
Plasmid#176251PurposepNOC episomal plasmid harboring the humanized fnCas12a gene sequence tagged with Nlux and type IIS restriction site for endonuclease BaeI at the crRNA region that facilitates the generation of mulitplDepositorInserthumanized fnCas12a
UseCRISPR, Luciferase, and Synthetic Biology ; Expre…TagsluciferaseAvailable SinceNov. 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
LV-indLS2
Plasmid#123068PurposeLentiviral construct that delivers a tamoxifen inducible Cre. Upon recombination, luc2 and mStrawberry express. Used to image spontaneous tumorigenesis or subclonal cell populations in vivo.DepositorInsertsCreERT2 with intron
Firefly luciferase
mStrawberry
UseLentiviral and Luciferase; FluorescenceExpressionMammalianMutationsynthetic intron added as indicatedPromoterCAGGS (after Cre mediated inversion) and CAGGS (f…Available SinceApril 3, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLX302_HOXB13
Plasmid#70089PurposeExpression of human HOXB13 from CMV promoter, puromycin selection markerDepositorAvailable SinceNov. 6, 2015AvailabilityAcademic Institutions and Nonprofits only -
pKM19
Plasmid#123655PurposeEncodes firefly luciferase under the pIEx promoter for constitutive expression in insect (e.g. Drosophila, mosquito) cellsDepositorInsertFirefly luciferase
UseLuciferaseExpressionInsectPromoterpIExAvailable SinceMay 7, 2019AvailabilityAcademic Institutions and Nonprofits only -
pBJG1 T7-8xHis-OGT K842M
Plasmid#154272PurposeBacterial expression of full length human OGT with K842M mutation (catalytically inactive). N-terminal T7_leader-8xHis tag followed by HRV3C protease site.DepositorInsertO-GlcNAc Transferase (OGT Human)
Tags8x His, HRV3C protease site, and T7 leaderExpressionBacterialMutationLysine 842 changed to Methionine- bacterial codon…Available SinceSept. 9, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLIX405-KANK1
Plasmid#121984Purposetetracycline-inducible expression of C-terminal GFP tagged KANK1DepositorAvailable SinceFeb. 28, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-DIO-Gluc-RMA-IRES-EGFP
Plasmid#189630PurposeExpresses Gluc-RMA and EGFP in the presence of Cre recombinase. Double-floxed Gluc-RMA and EGFP for monitoring Cre-expressing neuronal populations.DepositorInsertsGaussia luciferase fused to Fc
IRES-EGFP
UseAAV, Cre/Lox, and LuciferaseTagsGluc and IgG1 FcExpressionMammalianPromoterIRES and hSynAvailable SinceNov. 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
pET-Sac-Abeta(MC1-42)
Plasmid#127151PurposeExpresses N-terminal cysteine Abeta(1-42)DepositorAvailable SinceJuly 9, 2019AvailabilityAcademic Institutions and Nonprofits only -
plv-AcGFP-SOD1 (G93A)
Plasmid#27142DepositorAvailable SinceMarch 18, 2011AvailabilityAcademic Institutions and Nonprofits only -
pGL3 1 kb prom and exon1 fragment CD274
Plasmid#107006PurposeModified Luciferase expression vectorDepositorAvailable SinceMarch 23, 2018AvailabilityAcademic Institutions and Nonprofits only -
PB-CAG-ChR2-YFP
Plasmid#204345PurposePiggyBac transposon vector suitable for inserting the ChR2-YFP optogenetic actuator driven by the ubiquitous CAG promoter into the genome of mammalian cell lines.DepositorInsertChR2-YFP
TagsYellow fluorescent proteinExpressionMammalianMutationC-terminus (aa315-737) is deleted - PMID: 1461559…PromoterCAGAvailable SinceOct. 18, 2023AvailabilityAcademic Institutions and Nonprofits only