We narrowed to 13,769 results for: bli
-
Plasmid#52515Purposeexpresses C. elegans LIN-29 in mammalian cells with RGS-6xHis tag at N-terminusDepositorInsertLin-29 b (lin-29 Nematode)
TagsRGS-6xHisExpressionMammalianMutationwt (changed coding sequence in 5' (5th codon…PromoterCMVAvailable SinceAug. 4, 2015AvailabilityAcademic Institutions and Nonprofits only -
pCMV5b HA Irx5 deltaHD
Plasmid#24997DepositorAvailable SinceAug. 2, 2010AvailabilityAcademic Institutions and Nonprofits only -
HS1BP3-PX (17-139)
Plasmid#119125PurposeBacterial expression of human phox homology (PX) domain, HS1BP3-PX (17-139)DepositorAvailabilityAcademic Institutions and Nonprofits only -
GBX
Plasmid#64123Purposea modified episomal (EBNA1/OriP) vector expressing human eGFP and BCL-xL genesDepositorAvailable SinceAug. 11, 2015AvailabilityAcademic Institutions and Nonprofits only -
pCS2+MLS-HyPer7
Plasmid#136470PurposeMammalian expression of mitochondrial matrix targeted ultrasensitive hydrogen peroxide indicator HyPer7 for optical imagingDepositorInsertHyPer7
TagsTandem mitochondrial targeting signal of cytochro…ExpressionMammalianPromoterCMV, SP6Available SinceFeb. 11, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-UBC-FLEX-XRI-FLAG
Plasmid#178057PurposeExpression Recording Islands (XRIs) for recording cellular physiological histories along intracellular protein self-assembly. Contains XRI subunit with FLAG tag, under UBC promoter with a FLEX switch.DepositorInsertXRI-FLAG
UseAAVTagsFLAG-MBPExpressionMammalianPromoterHuman ubiquitin C (UBC) promoterAvailable SinceOct. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
FLAG-HA-FbxO11-ΔFbox-pcDNA3.1-
Plasmid#52502Purposeexpresses human FbxO11-ΔFbox in mammalian cells with FLAG-HA tag at N-terminusDepositorInsertFbxO11 (FBXO11 Human)
TagsFLAG-HAExpressionMammalianMutationdeletion of Fbox (deleted aa 71-116)PromoterCMVAvailable SinceJuly 31, 2015AvailabilityAcademic Institutions and Nonprofits only -
AAVS1 intron 1 gRNA as2
Plasmid#132394PurposeTargets AAVS1 intron 1, gRNA: AGAACCAGAGCCACATTAAC, MLM3636 backboneDepositorAvailable SinceMay 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCS2+HyPer7-NLS
Plasmid#136468PurposeMammalian expression of nucleus targeted ultrasensitive hydrogen peroxide indicator HyPer7 for optical imagingDepositorInsertHyPer7
TagsTriple nuclear localization signal of SV40 (simia…ExpressionMammalianPromoterCMV, SP6Available SinceAug. 18, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCS2+HyPer7-NES
Plasmid#136467PurposeMammalian expression of cytoplasm targeted ultrasensitive hydrogen peroxide indicator HyPer7 for optical imagingDepositorInsertHyPer7
TagsNuclear export signal from the HIV Rev proteinExpressionMammalianPromoterCMV, SP6Available SinceFeb. 11, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCS2+IMS-HyPer7
Plasmid#136469PurposeMammalian expression of mitochondrial intermembrane space targeted ultrasensitive hydrogen peroxide indicator HyPer7 for optical imagingDepositorInsertHyPer7
TagsSMAC/DIABLOExpressionMammalianPromoterCMV, SP6Available SinceFeb. 11, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCMV-HyPer7-MEM
Plasmid#136465PurposeMammalian expression of cytosolic side of plasma membrane targeted ultrasensitive hydrogen peroxide indicator HyPer7 for optical imagingDepositorInsertHyPer7
TagsFarnselation tagExpressionMammalianPromoterCMVAvailable SinceAug. 18, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-3xsgRNA_Opn1mw-RHO-Cas9N-IntN-polyA
Plasmid#165450PurposeExpress N-terminal part of split dCas9-VPR and 3 sgRNAs targeting murine Opn1mw promoterDepositorInsertsdCas9N-IntN
3x Opn1mw promoter-targeting sgRNAs
UseAAV and CRISPRExpressionMammalianPromoterU6 and short human rhodopsin promoterAvailable SinceDec. 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
-
pCDF RBP-FL P53
Plasmid#174042PurposeExpress Full length P53 in E.coli with cleavable expression/purification tag (ribose binding protein)DepositorInsertP53 gene (TP53 Human)
TagsThermoanaerobacter Tencongenesis ribose binding p…ExpressionBacterialPromoterT7Available SinceOct. 7, 2021AvailabilityAcademic Institutions and Nonprofits only -
GAG-CRErec
Plasmid#119971PurposeExpresses GAG (FMLV) fused with CRE recombinase for the production of VLPs loaded with CRE proteinDepositorInsertGAG-nlsCRErec
TagsnlsExpressionMammalianPromoterhCMVAvailable SinceApril 9, 2019AvailabilityAcademic Institutions and Nonprofits only -
MBX
Plasmid#64122Purposea modified episomal (EBNA1/OriP) vector expressing human BCL2L1 (BCL-xL) geneDepositorAvailable SinceAug. 11, 2015AvailabilityAcademic Institutions and Nonprofits only -
pNL(CMV)Luc2-Turbo RFP/CMV/WPREdU3
Plasmid#136959PurposeReporter vector encoding firefly luciferase and TurboRFP fluorescent proteinDepositorInsertFirefly luciferase and TurboRFP
UseLentiviralTagsV5 tagPromoterCMVAvailable SinceFeb. 7, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLV-SspB-HaloTag-p63DH
Plasmid#176129PurposeHeterodimerization with iLID, RhoA activationDepositorInsertRHOGEF p63 (ARHGEF25 Human)
UseLentiviralAvailable SinceFeb. 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
BICstim-Gag-dCAS9-VPR
Plasmid#120922Purposeencodes a GAG-dCAS9-VPR fusion for targeted transcriptional activation.DepositorInsertGAG (FMLV)-dCAS9-VPR
TagsnoneExpressionMammalianPromoterhCMVAvailable SinceApril 9, 2019AvailabilityAcademic Institutions and Nonprofits only