We narrowed to 42,102 results for: Eras
-
Plasmid#155084PurposeLentiviral plasmid for expressing U6 driven hybrid guide (hg)RNA for deletion of mouse Ptbp exon 8 using SpCas9 and LbCas12a nucleases (CHyMErA system)DepositorInsert(hg)RNA for deletion of mouse Ptbp exon 8 using SpCas9 and LbCas12a nucleases
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceAug. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLCHKO_SFRS7_exon_deletion_4
Plasmid#155072PurposeLentiviral plasmid for expressing U6 driven hybrid guide (hg)RNA for deletion of SFRS7 exon using SpCas9 and LbCas12a nucleases (CHyMErA system)DepositorInsert(hg)RNA for deletion of SFRS7 exon using SpCas9 and LbCas12a nucleases
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceAug. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLCHKO_Ptbp_ex8_2
Plasmid#155082PurposeLentiviral plasmid for expressing U6 driven hybrid guide (hg)RNA for deletion of mouse Ptbp exon 8 using SpCas9 and LbCas12a nucleases (CHyMErA system)DepositorInsert(hg)RNA for deletion of mouse Ptbp exon 8 using SpCas9 and LbCas12a nucleases
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceAug. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLCHKO_PDPR_exon_deletion_3
Plasmid#155067PurposeLentiviral plasmid for expressing U6 driven hybrid guide (hg)RNA for deletion of PDPR exon using SpCas9 and LbCas12a nucleases (CHyMErA system)DepositorInsert(hg)RNA for deletion of PDPR exon using SpCas9 and LbCas12a nucleases
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceAug. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLCHKO_PDPR_exon_deletion_4
Plasmid#155068PurposeLentiviral plasmid for expressing U6 driven hybrid guide (hg)RNA for deletion of PDPR exon using SpCas9 and LbCas12a nucleases (CHyMErA system)DepositorInsert(hg)RNA for deletion of PDPR exon using SpCas9 and LbCas12a nucleases
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceAug. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
EcNGsC-F307Y-pKK223
Plasmid#131381PurposeLow level expression of E.coli G.stearothermophillus MutY chimera protein with amino acid change F307Y in Gs MutY.DepositorInsertEcNGsC MutY chimera F307Y
ExpressionBacterialMutationFusion of two MutY genes. Residues 1-225 are from…PromotertacAvailable SinceJan. 8, 2020AvailabilityAcademic Institutions and Nonprofits only -
EcNGsC-F307A-pKK223
Plasmid#131382PurposeLow level expression of E.coli G.stearothermophillus MutY chimera protein with amino acid change F307A in Gs MutY.DepositorInsertEcNGsC MutY chimera F307A
ExpressionBacterialMutationFusion of two MutY genes. Residues 1-225 are from…PromotertacAvailable SinceJan. 8, 2020AvailabilityAcademic Institutions and Nonprofits only -
EcNGsC-S308V-pKK223
Plasmid#131393PurposeLow level expression of E.coli G.stearothermophillus MutY chimera protein with amino acid change S308V in Gs MutY.DepositorInsertEcNGsC MutY chimera S308V
ExpressionBacterialMutationFusion of two MutY genes. Residues 1-225 are fro…PromotertacAvailable SinceJan. 8, 2020AvailabilityAcademic Institutions and Nonprofits only -
EcNGsC-S308A-pKK223
Plasmid#131394PurposeLow level expression of E.coli G.stearothermophillus MutY chimera protein with amino acid change S308A in Gs MutY.DepositorInsertEcNGsC MutY chimera S308A
ExpressionBacterialMutationFusion of two MutY genes. Residues 1-225 are fro…PromotertacAvailable SinceJan. 8, 2020AvailabilityAcademic Institutions and Nonprofits only -
hnRNPA2_LC_WT_S285C
Plasmid#98665PurposeExpresses 6xHis-tagged hnRNPA2 AA 190-341 with S285CDepositorAvailable SinceJan. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
hnRNPA2_LC_WT_S329C
Plasmid#98667PurposeExpresses 6xHis-tagged hnRNPA2 AA 190-341 with S329CDepositorAvailable SinceJan. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
hnRNPA2_LC_D290V
Plasmid#98658PurposeExpresses 6xHis-tagged hnRNPA2 AA 190-341 with D290VDepositorAvailable SinceJan. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
hnRNPA2_LC_D220V
Plasmid#98659PurposeExpresses 6xHis-tagged hnRNPA2 AA 190-341 with D220VDepositorAvailable SinceJan. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
hnRNPA2_LC_D230V
Plasmid#98660PurposeExpresses 6xHis-tagged hnRNPA2 AA 190-341 with D230VDepositorAvailable SinceJan. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
hnRNPA2_LC_P298L
Plasmid#104465Purposeexpress His tagged P298L hnRNPA2 LCDepositorAvailable SinceJan. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
MBP-hnRNPA2_LC_R191K_R254K
Plasmid#104466Purposeexpress MBP hnRNPA2 LC with 2 R to K mutationsDepositorAvailable SinceJan. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
hnRNPA2_LC_P298L_S329C
Plasmid#104470Purposeexpress His tagged P298L S329C hnRNPA2 LCDepositorAvailable SinceJan. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pJC20cdc8.27
Plasmid#99362PurposeBacterial expression vector containing cDNA encoding for the temperature sensitive fission yeast tropomyosin mutant, Cdc8.27.DepositorInsertcdc8 (cdc8 Fission Yeast)
ExpressionBacterialMutationGlutamic acid 129 to LysinePromoterT7Available SinceOct. 31, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-shGBP1.2.mKO2
Plasmid#85210PurposeTRCN0000116120 (Target TGAGACGACGAAAGGCATGTA) for silencing GBP1 gene and express monomeric Kusabira-Orange2.DepositorInsertGBP1 (guanylate binding protein 1) (GBP1 Human)
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceOct. 4, 2017AvailabilityAcademic Institutions and Nonprofits only -
pGL3-Basic-Fascin-Promoter (-210-0)
Plasmid#89826PurposeFascin promoter for luciferase assayDepositorAvailable SinceMay 11, 2017AvailabilityAcademic Institutions and Nonprofits only