We narrowed to 45,377 results for: INA
-
Plasmid#84635PurposeEncodes C-terminal (substrate) fragment of bimolecular AMPK/BRSK activity reporter (bimABKAR); cytosol targeted; use in conjunction with pcDNA3-Cerulean-FHA1-NESDepositorInsertAMPKsub-YPet-NES
Tags6xHis, Nuclear export signal (NES), T7 tag (gene …ExpressionMammalianPromoterCMVAvailable SinceApril 27, 2018AvailabilityAcademic Institutions and Nonprofits only -
TDP-43_CTD_M337P
Plasmid#98675PurposeExpresses 6xHis-tagged C-terminal domain of TDP-43 with M337PDepositorAvailable SinceJuly 27, 2017AvailabilityAcademic Institutions and Nonprofits only -
TDP-43_CTD_A326P
Plasmid#98672PurposeExpresses 6xHis-tagged C-terminal domain of TDP-43 with A326PDepositorAvailable SinceJuly 27, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCMV-MfPylRS (human-opti)
Plasmid#164081PurposeTo express a Methanosarcina flavescens derived PylRS in mammalian cells for genetic code expansionDepositorInsertMfPylRS(human-opti)
UseSynthetic BiologyExpressionMammalianPromoterCMVAvailable SinceFeb. 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
plenti hSyn PGK1-HALO
Plasmid#220910PurposeNeuronal specific expression of the fusion construct PGK1-HALODepositorAvailable SinceJune 14, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3HA-ErbB4CTF
Plasmid#17803DepositorInsertErbB4 (ERBB4 Human)
TagsHAExpressionMammalianMutationCarboxy-terminal fragment, amino acids 676-1292Available SinceMay 9, 2008AvailabilityAcademic Institutions and Nonprofits only -
Sema3e(L)-Fc-His
Plasmid#72145PurposeExpresses the Sema3E protein (truncated at cleavage site P3; ie, long), C-terminally fused to the Fc region of human IgG1 + 6X histidine tag.DepositorAvailable SinceFeb. 26, 2016AvailabilityAcademic Institutions and Nonprofits only -
myc-POMP
Plasmid#86764PurposeN-terminal myc-tagged protein expression in mammalian cellsDepositorAvailable SinceJan. 26, 2017AvailabilityAcademic Institutions and Nonprofits only -
L-RARS-5
Plasmid#166535PurposescFv of a human scaffold targeting Arginyl-tRNA synthetase. Antigen coverage aa 70-660 of 660DepositorInsertsingle chain-Fv, scFv
UseRecombinant antibody expressionTags3xFLAG, His6 and OmpA leader sequenceExpressionBacterialPromoterLacZAvailable SinceApril 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
L-KARS-5
Plasmid#166530PurposescFv of a human scaffold targeting Lysyl-tRNA synthetase. Antigen coverage aa 1-597 of 597, full-lengthDepositorInsertsingle chain-Fv, scFv
UseRecombinant antibody expressionTags3xFLAG, His6 and OmpA leader sequenceExpressionBacterialPromoterLacZAvailable SinceApril 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
O-DARS-1
Plasmid#166538PurposescFv of a human scaffold targeting Aspartyl-tRNA synthetase. Antigen coverage aa 1-501 of 501, full-lengthDepositorInsertsingle chain-Fv, scFv
UseRecombinant antibody expressionTags3xFLAG, His6 and OmpA leader sequenceExpressionBacterialPromoterLacZAvailable SinceApril 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
O-LARS-15
Plasmid#166542PurposescFv of a human scaffold targeting Leucyl-tRNA synthetase. Antigen coverage aa 260-509 of 1176DepositorInsertsingle chain-Fv, scFv
UseRecombinant antibody expressionTags3xFLAG, His6 and OmpA leader sequenceExpressionBacterialPromoterLacZAvailable SinceMarch 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
J-HARS-4
Plasmid#166529PurposescFv of a human scaffold targeting Histidyl-tRNA synthetase. Antigen coverage aa 1-509 of 509, full-lengthDepositorInsertsingle chain-Fv, scFv
UseRecombinant antibody expressionTags3xFLAG, His6 and OmpA leader sequenceExpressionBacterialPromoterLacZAvailable SinceApril 28, 2021AvailabilityAcademic Institutions and Nonprofits only -
L-SARS-7
Plasmid#166527PurposescFv of a human scaffold targeting Seryl-tRNA synthetase. Antigen coverage aa 1-514 of 514, full-lengthDepositorInsertsingle chain-Fv, scFv
UseRecombinant antibody expressionTags3xFLAG, His6 and OmpA leader sequenceExpressionBacterialPromoterLacZAvailable SinceApril 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
pT/Caggs-NRAS G12V-IRES-ASK1
Plasmid#221074PurposeExpresses NRAS G12V and ASK1 in mammalian cellsDepositorAvailable SinceJuly 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pFastBacDual with LFn + FlaAAA
Plasmid#84867PurposeBaculovirus Expression of LFn-FlaAAA fusion. This is a negative control for LFn FlaA in which the 3 C-terminal leucines have been replaced by alanine.DepositorInsertsLFn
FlaAAA
UseBaculovirusTags6xHisExpressionInsectMutation3 C-terminal leucines have been replaced by alani…PromoterPolyhedrinAvailable SinceNov. 10, 2016AvailabilityAcademic Institutions and Nonprofits only -
Sema6d.1-Fc-His
Plasmid#72168PurposeExpresses the extracellular region of the Sema6D, isoform 1 protein, C-terminally fused to the Fc region of human IgG1 + 6X histidine tag.DepositorAvailable SinceMarch 11, 2016AvailabilityAcademic Institutions and Nonprofits only -
HcRed-pcw107-V5
Plasmid#64647Purpose(control) when used to produce lentivirus, express physiological levels of insertDepositorInsertn/a
UseLentiviralTagsV5PromoterPGKAvailable SinceJuly 8, 2015AvailabilityAcademic Institutions and Nonprofits only -
pR008_APAD
Plasmid#204818PurposeExpression Apobec1-ADAR2dd fusion protein as PIE-RBP controlDepositorInsertrat Apobec1 and human ADAR2 deaminase domain with engineered sites (Apobec1 Rat)
TagsHA and Flag and huADAR2ddExpressionMammalianPromoterchicken β-actin promoterAvailable SinceNov. 10, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-eYFP-3x-miR708-5p-TS
Plasmid#117381PurposeAn AAV genome containing miRNA target sequence (TS) 708-5p to reduce expression of the fluorescent protein eYFP in neuronsDepositorInsertEYFP + 3 copies of miR708: CCCAGCTAGATTGTAAGCTCCTT
UseAAVExpressionMammalianPromoterCAGAvailable SinceOct. 18, 2018AvailabilityAcademic Institutions and Nonprofits only