We narrowed to 14,520 results for: SHR
-
Plasmid#196296Purpose35S promoter-driven expression of the positive-sense TSWV S RNA segment encoding sgRNA:GFP fusion in place of viral NSsDepositorInsertFull length TSWV S antigenome encoding sgRNA:GFP fusion in place of viral NSs
UseCRISPRExpressionPlantPromoterduplicated cauliflower mosaic virus 35S promoterAvailable SinceApril 10, 2023AvailabilityAcademic Institutions and Nonprofits only -
pX462-hPRKAA1-gRNA_B
Plasmid#74375PurposegRNA_B to knockout human AMPK alpha 1 using Cas9nDepositorAvailable SinceApril 27, 2016AvailabilityAcademic Institutions and Nonprofits only -
pX462-hPRKAA1-gRNA_A
Plasmid#74374PurposegRNA_A to knockout human AMPK alpha 1 using Cas9nDepositorAvailable SinceApril 14, 2016AvailabilityAcademic Institutions and Nonprofits only -
pSLQ14901
Plasmid#239276PurposeExpresses gG1 for pertubing endogenous human GAPDH mRNA via CRISPR-TODepositorAvailable SinceSept. 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAX198
Plasmid#173042PurposeCustom vector for sgRNA library constructionDepositorInsertHBB Gene - Second and third exons of ENST00000647020.1 (no intron) and part of the 3' UTR (HBB Human)
UseCRISPR and LentiviralExpressionMammalianPromotermouse U6Available SinceNov. 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
pX330-PITCh-TOMM20
Plasmid#207789PurposeExpresses SpCas9, the PITCh gRNA, and a sgRNA targeting the C-terminus of TOMM20 for knock-in.DepositorInsertsgRNA Targeting C-terminus of TOMM20 (TOMM20 Human)
UseCRISPRExpressionMammalianPromoterU6Available SinceDec. 1, 2023AvailabilityAcademic Institutions and Nonprofits only -
pX330-RPA194
Plasmid#247352PurposeExpresses SpCas9 and a sgRNA targeting the human RPA194 loci for knock-in.DepositorAvailable SinceNov. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-U6-DR36(DjCas13d-SapI)-CMV-intron-MCS-pA
Plasmid#233031PurposeTo express a DjCas13d-compatible gRNADepositorInsertDjCas13d-compatible gRNA expression cassette
UseAAVAvailable SinceMarch 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-U6-DR30(sapI)-CMV-intron-hfCas13d-pA
Plasmid#195865PurposeTo express hfCas13dDepositorInserthigh fidelity (hf) version of CasRx (hfCas13d)
UseAAVMutationYes: GTGGAATACATTACCAACGTGGTGTACGTGPromoterCMVAvailable SinceJan. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
Cas9-GFP_sg_mTfeb
Plasmid#79006PurposeExpresses WT Cas9 and GFP, along with a sgRNA to mouse Tfeb.DepositorAvailable SinceJune 22, 2016AvailabilityAcademic Institutions and Nonprofits only -
pSLQ14902
Plasmid#239277PurposeExpresses gG2 for pertubing endogenous human GAPDH mRNA via CRISPR-TODepositorAvailable SinceSept. 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pDF0114 pU6-Eco31i-Eco31i-DisCas7-11 mature DR guide scaffold with golden gate site
Plasmid#172508PurposeEncodes the mature DisCas7-11 DR along with a golden gate site for spacer cloningDepositorInsertpU6-Eco31i-Eco31i-DisCas7-11 mature DR guide scaffold with golden gate site
ExpressionMammalianAvailable SinceOct. 7, 2021AvailabilityAcademic Institutions and Nonprofits only -
pENN496_miniCRISPRcharm_dSaCas9
Plasmid#220837Purposemini CRISPRcharm expression in mammalian cellsDepositorInsertmini CRISPRcharm
UseCRISPRTagsP2A-TagBFPExpressionMammalianMutationN/APromoterEFSAvailable SinceJune 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
EF1a-dCas9-KRAB-GFP backbone
Plasmid#194281PurposeVector for CRISPRi-GFP expression ready for gateway cloning of sgRNADepositorInsertdCas9-KRAB-GFP
UseCRISPR and LentiviralTagsGFPPromoterEF1aAvailable SinceJune 14, 2023AvailabilityAcademic Institutions and Nonprofits only -
pX601-mCherry
Plasmid#84039PurposeStaphylococcus aureus (SaCas9) conjugated with mCherryDepositorInsertSaCas9
UseAAV and CRISPRTagsNLS and T2A-mCherryExpressionMammalianPromoterCMVAvailable SinceDec. 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
-
px459 sgAtg5
Plasmid#175023PurposeCRISPR-Cas9 plasmid targeting exon 2 of human Atg5.DepositorInsertATG5 (ATG5 Human)
ExpressionMammalianAvailable SinceOct. 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
U6-sgRNA(HEK3)-CMV-SpCas9(D10A)-P2A-EGFP
Plasmid#221233PurposeExpress sgRNA targeting HEK3 loci with nCas9(D10A)DepositorInsertSpCas9(D10A)-P2A-EGFP
ExpressionMammalianAvailable SinceJune 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDL560
Plasmid#231161PurposeT-DNA encoding TRV2 with ipt and mobile gRNA targeting SlPDSDepositorInsertipt and mobile gRNA targeting SlPDS
ExpressionPlantPromoterPEBV sub-genomicAvailable SinceMarch 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
LENTICRISPR-SNRNP70_sgRNA1
Plasmid#201620PurposeCRISPR/Cas9-mediated gene knock-outDepositorInsertSNRNP70 (SNRNP70 Human)
UseCRISPR and LentiviralAvailable SinceJune 22, 2023AvailabilityAcademic Institutions and Nonprofits only